ID: 1057227717

View in Genome Browser
Species Human (GRCh38)
Location 9:93301365-93301387
Sequence GACCCACATGGACCTCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 86}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057227717_1057227721 -10 Left 1057227717 9:93301365-93301387 CCCATCAGAGGTCCATGTGGGTC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1057227721 9:93301378-93301400 CATGTGGGTCATCATTCTCCGGG No data
1057227717_1057227725 12 Left 1057227717 9:93301365-93301387 CCCATCAGAGGTCCATGTGGGTC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1057227725 9:93301400-93301422 GCAGGCAATTCGAGGACACAAGG No data
1057227717_1057227723 4 Left 1057227717 9:93301365-93301387 CCCATCAGAGGTCCATGTGGGTC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1057227723 9:93301392-93301414 TTCTCCGGGCAGGCAATTCGAGG No data
1057227717_1057227722 -6 Left 1057227717 9:93301365-93301387 CCCATCAGAGGTCCATGTGGGTC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1057227722 9:93301382-93301404 TGGGTCATCATTCTCCGGGCAGG No data
1057227717_1057227726 13 Left 1057227717 9:93301365-93301387 CCCATCAGAGGTCCATGTGGGTC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1057227726 9:93301401-93301423 CAGGCAATTCGAGGACACAAGGG No data
1057227717_1057227727 22 Left 1057227717 9:93301365-93301387 CCCATCAGAGGTCCATGTGGGTC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1057227727 9:93301410-93301432 CGAGGACACAAGGGCCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057227717 Original CRISPR GACCCACATGGACCTCTGAT GGG (reversed) Intronic
900945309 1:5827994-5828016 GTCACACATTTACCTCTGATTGG + Intergenic
902814442 1:18908126-18908148 GTCCCACCTGCTCCTCTGATTGG - Exonic
907332299 1:53679157-53679179 GGCCACCCTGGACCTCTGATGGG + Intronic
907879212 1:58529256-58529278 CACCCAGATGGCACTCTGATGGG + Intronic
908791053 1:67781936-67781958 GACCCACATGTACCTATTATTGG - Intronic
909057041 1:70833723-70833745 GGCCCTCATGGATCTCTGCTAGG + Intergenic
911008413 1:93252908-93252930 GGCCCACATGGACCTGGGAAGGG + Intronic
912472728 1:109916655-109916677 GACCCATATGCACCTCTGTTAGG + Intronic
921785075 1:219220213-219220235 GGCCCACATGGACCGCTGTAGGG + Intergenic
1069350604 10:67521759-67521781 GACCCACCTGCACCTCTGACAGG + Intronic
1071337078 10:84609277-84609299 CACCCACAGGGACCTGAGATTGG - Intergenic
1071554544 10:86592310-86592332 GATGCTCATGGACCTCTGAAGGG + Intergenic
1077134539 11:991922-991944 CACCCACATGGAGCTCTGCCAGG - Intronic
1085183941 11:74559605-74559627 AGCCCACAGGGACCTTTGATGGG + Intronic
1085722173 11:78922116-78922138 GCTGCACATGGACATCTGATAGG - Intronic
1086601540 11:88640209-88640231 GACACAAATGGGCTTCTGATCGG + Intronic
1087707670 11:101513208-101513230 GTCCCACAAGTGCCTCTGATGGG + Intronic
1088884075 11:113993603-113993625 CTCCCAACTGGACCTCTGATAGG - Intergenic
1090251130 11:125252684-125252706 GAGCTACATGGACCTCTCATTGG - Intronic
1093452991 12:19336899-19336921 GACACAGATGGACCTGTGAAAGG - Intronic
1093644869 12:21573783-21573805 GATCCACATGCAGCTCTGAGTGG - Intronic
1095994356 12:48067447-48067469 GAGCCACATGGACCTAGAATTGG - Intronic
1102107249 12:110336000-110336022 CAGCCACATGGTCCTCTAATAGG + Intronic
1107749170 13:43545879-43545901 GAGCTACACAGACCTCTGATAGG + Intronic
1119516821 14:75254834-75254856 CACCCACATGGACCTCTCTATGG + Intronic
1121877081 14:97463180-97463202 GGGCCACATGGAATTCTGATAGG + Intergenic
1125476941 15:40054149-40054171 GACCAACCTGGACCTGTGACAGG + Intergenic
1125527858 15:40389654-40389676 GATCCACATGGAATCCTGATGGG + Intronic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1138376700 16:56569193-56569215 CACCCACATGTACCTGTGACAGG + Intergenic
1138692757 16:58784507-58784529 GACCAAAATCTACCTCTGATTGG - Intergenic
1142186129 16:88695526-88695548 GAGCCACGTGGGCCTCTGACTGG - Intergenic
1142519927 17:497685-497707 GACCACCATGGTCCTCCGATTGG + Intergenic
1142883982 17:2901418-2901440 GACCCACAAGGACCCATGAGAGG - Intronic
1145798516 17:27669357-27669379 GACCCACAGGGACCCATGGTAGG - Intergenic
1147800398 17:43081805-43081827 AATCCAGATGGACCTCTGAGAGG - Intronic
1151077198 17:71287515-71287537 GCAGCACACGGACCTCTGATTGG + Intergenic
1152104128 17:78318981-78319003 GACCCACATGGCCCTTTGGTGGG - Intergenic
1157848091 18:51022486-51022508 GTTCCACATAGATCTCTGATAGG - Intronic
1158273451 18:55741502-55741524 GACCCACATGGAAATGTGAAAGG - Intergenic
1163289685 19:16371153-16371175 GACCCACATGGGCACATGATGGG + Intronic
1163795115 19:19333526-19333548 GACCCACATGGGCCTGAGCTCGG + Intronic
1163818195 19:19480742-19480764 GACCCACGAGGACCACTGAGGGG - Intronic
1164987480 19:32659009-32659031 GAGCCATATGGACTTCAGATGGG + Exonic
1166144685 19:40826009-40826031 AACCCACAGGGACCCCAGATGGG - Intronic
1166183058 19:41122198-41122220 AACCCACAGGGACCCCAGATGGG + Intronic
1168067356 19:53925705-53925727 GTCTCACAGGGACCTCTGCTGGG + Intronic
926087129 2:10027568-10027590 GACCCACTTGGGCCACTGGTGGG + Intergenic
927409524 2:22808272-22808294 TTACCACATGGACCTCTTATAGG - Intergenic
928576079 2:32656683-32656705 GACACACATGGACCCCTCCTTGG + Intronic
932467548 2:71933324-71933346 GACCCACAAGGACTCCTGCTGGG + Intergenic
934916791 2:98306567-98306589 GACCCACAGGGACCATTGTTGGG - Intronic
936490715 2:112969808-112969830 GACCCCCATGGAGCACTGACAGG + Intergenic
938943748 2:136191991-136192013 GACCCACATGGTCCTTAGTTTGG + Intergenic
946313214 2:218894344-218894366 GTCTCACATGGATCGCTGATGGG + Intronic
948288666 2:236807929-236807951 GACCCACCTGGGCCTCTCAAAGG - Intergenic
1169939326 20:10919847-10919869 GACCCTCATGGACCTCCGCCAGG - Intergenic
1172157700 20:32840351-32840373 GATCCACAGAGACCTCTGACAGG - Intronic
1173048171 20:39532557-39532579 GACCCACAGGGAACTCTGGAGGG - Intergenic
1180205589 21:46257516-46257538 GACCCACAGCCACCACTGATAGG + Intronic
1182083591 22:27545910-27545932 GAGCCACATGGATCTCACATGGG - Intergenic
1182923347 22:34100256-34100278 CACCCACATGGAACTCTGCCAGG - Intergenic
1183518004 22:38278886-38278908 GTCCCACAGTCACCTCTGATTGG + Intergenic
1183627328 22:39012656-39012678 GGCCCACAGGGACCTCTCAAGGG - Intergenic
960037495 3:113116582-113116604 GACCCTCATGTACCACTGGTGGG - Intergenic
970442488 4:16093692-16093714 GACCCACAAGGAGCTCTGCCAGG - Intergenic
971787432 4:31123396-31123418 GACCCCCTTGGACTTCTGAAAGG + Intronic
978458132 4:108918482-108918504 GAGCCATGTGGCCCTCTGATAGG - Intronic
983425219 4:167575162-167575184 GAGCCAGATGGCCCTCTCATGGG + Intergenic
986051927 5:4098297-4098319 CAGTCACATGGACCACTGATGGG + Intergenic
990363845 5:55049062-55049084 GACCCAAATGGACCACTAATTGG - Intergenic
994267671 5:97737826-97737848 GCCCCACAGGGTCCTCAGATTGG + Intergenic
997503684 5:134398733-134398755 GACCCACATCCATCACTGATAGG + Intergenic
999120899 5:149208697-149208719 GACCCACAGGGACCTCAACTGGG + Intronic
999848973 5:155516908-155516930 GACCTGCATGGAACTCTGATGGG + Intergenic
1003180215 6:3784590-3784612 GACTCACATCCACCTGTGATAGG - Intergenic
1014905942 6:127027342-127027364 GATTCACATGGACATATGATTGG - Intergenic
1015259917 6:131225288-131225310 AACCCACATGGGCTTCTGAGGGG - Intronic
1017767288 6:157616886-157616908 GAGCCACAAGGACCTCTGATGGG + Intronic
1030114873 7:106055468-106055490 GACCCACCTGGAAAACTGATGGG - Intergenic
1030477537 7:110055633-110055655 GACCCAAATCAACCTCAGATTGG + Intergenic
1034915975 7:155039346-155039368 GACCCAGAAGGACTCCTGATTGG - Intergenic
1035983115 8:4395086-4395108 CACCCACATGAACCTCCGCTGGG + Intronic
1037001812 8:13729033-13729055 GACACACATCGAACTCTGAGTGG - Intergenic
1037416878 8:18660706-18660728 GCTCCACATGTAACTCTGATTGG + Intronic
1045445914 8:102263672-102263694 CACCCCCATGTACCTCTTATAGG + Intronic
1049214126 8:141399846-141399868 GACCCACAAGGAGCTCACATGGG + Intronic
1049990651 9:988215-988237 GACGCAAATGAACCTCTCATTGG + Intronic
1057227717 9:93301365-93301387 GACCCACATGGACCTCTGATGGG - Intronic
1058674626 9:107389783-107389805 AACCCACATGGGCCTCTCAGAGG + Intergenic
1061257573 9:129461261-129461283 GACCCTCATCCACCGCTGATAGG + Intergenic
1199558764 X:149139860-149139882 CACCAACATAGATCTCTGATGGG - Intergenic
1199602477 X:149550342-149550364 GACTCATATGGACCCCTCATGGG + Intronic
1199647911 X:149929133-149929155 GACTCAGATGGACCCCTCATGGG - Intergenic
1201459620 Y:14207698-14207720 GACCCAAATTTACCTTTGATTGG + Intergenic