ID: 1057227959

View in Genome Browser
Species Human (GRCh38)
Location 9:93302378-93302400
Sequence CTGCAAGTAGAGGAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057227955_1057227959 -3 Left 1057227955 9:93302358-93302380 CCGAGGGGTCGGGGGTCGCGCTG 0: 1
1: 0
2: 1
3: 8
4: 216
Right 1057227959 9:93302378-93302400 CTGCAAGTAGAGGAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057227959 Original CRISPR CTGCAAGTAGAGGAGGAGCA GGG Intronic
No off target data available for this crispr