ID: 1057227959 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:93302378-93302400 |
| Sequence | CTGCAAGTAGAGGAGGAGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1057227955_1057227959 | -3 | Left | 1057227955 | 9:93302358-93302380 | CCGAGGGGTCGGGGGTCGCGCTG | 0: 1 1: 0 2: 1 3: 8 4: 216 |
||
| Right | 1057227959 | 9:93302378-93302400 | CTGCAAGTAGAGGAGGAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1057227959 | Original CRISPR | CTGCAAGTAGAGGAGGAGCA GGG | Intronic | ||
| No off target data available for this crispr | |||||