ID: 1057228498

View in Genome Browser
Species Human (GRCh38)
Location 9:93304871-93304893
Sequence CCCAGTGACCAGTGTGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 265}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057228498_1057228507 7 Left 1057228498 9:93304871-93304893 CCGTCTGCACACTGGTCACTGGG 0: 1
1: 0
2: 1
3: 27
4: 265
Right 1057228507 9:93304901-93304923 TTTAGGAGGGGCCCAAGTTTAGG No data
1057228498_1057228502 -7 Left 1057228498 9:93304871-93304893 CCGTCTGCACACTGGTCACTGGG 0: 1
1: 0
2: 1
3: 27
4: 265
Right 1057228502 9:93304887-93304909 CACTGGGGCCCAAGTTTAGGAGG No data
1057228498_1057228513 22 Left 1057228498 9:93304871-93304893 CCGTCTGCACACTGGTCACTGGG 0: 1
1: 0
2: 1
3: 27
4: 265
Right 1057228513 9:93304916-93304938 AGTTTAGGAAGGGCCCGTGGAGG No data
1057228498_1057228504 -5 Left 1057228498 9:93304871-93304893 CCGTCTGCACACTGGTCACTGGG 0: 1
1: 0
2: 1
3: 27
4: 265
Right 1057228504 9:93304889-93304911 CTGGGGCCCAAGTTTAGGAGGGG No data
1057228498_1057228508 11 Left 1057228498 9:93304871-93304893 CCGTCTGCACACTGGTCACTGGG 0: 1
1: 0
2: 1
3: 27
4: 265
Right 1057228508 9:93304905-93304927 GGAGGGGCCCAAGTTTAGGAAGG No data
1057228498_1057228512 19 Left 1057228498 9:93304871-93304893 CCGTCTGCACACTGGTCACTGGG 0: 1
1: 0
2: 1
3: 27
4: 265
Right 1057228512 9:93304913-93304935 CCAAGTTTAGGAAGGGCCCGTGG No data
1057228498_1057228503 -6 Left 1057228498 9:93304871-93304893 CCGTCTGCACACTGGTCACTGGG 0: 1
1: 0
2: 1
3: 27
4: 265
Right 1057228503 9:93304888-93304910 ACTGGGGCCCAAGTTTAGGAGGG No data
1057228498_1057228501 -10 Left 1057228498 9:93304871-93304893 CCGTCTGCACACTGGTCACTGGG 0: 1
1: 0
2: 1
3: 27
4: 265
Right 1057228501 9:93304884-93304906 GGTCACTGGGGCCCAAGTTTAGG No data
1057228498_1057228509 12 Left 1057228498 9:93304871-93304893 CCGTCTGCACACTGGTCACTGGG 0: 1
1: 0
2: 1
3: 27
4: 265
Right 1057228509 9:93304906-93304928 GAGGGGCCCAAGTTTAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057228498 Original CRISPR CCCAGTGACCAGTGTGCAGA CGG (reversed) Intronic
900083813 1:877176-877198 CTCAGACCCCAGTGTGCAGAAGG - Intergenic
900280323 1:1863046-1863068 CCCAGTGTCCACAGTGCTGAGGG - Intronic
900689890 1:3974136-3974158 CCCCGTGTGCAGTGAGCAGATGG + Intergenic
900836922 1:5011763-5011785 CCCAGTGGCCAGTGGGTAGTTGG + Intergenic
900974958 1:6011233-6011255 CCCAGGGCCAAGTGTGCAGGAGG + Intronic
901494941 1:9615490-9615512 CCCAGTGCCCAGCGGGCAGGAGG + Intergenic
902713712 1:18258044-18258066 CCCAGGCACCAATGTGCAGGAGG + Intronic
902850152 1:19148980-19149002 CCCAGAGATCAGTGGGCAAAAGG + Intronic
903738098 1:25543313-25543335 TCCAGTGACCATTTTACAGATGG - Intergenic
904993360 1:34611995-34612017 GGCAGAGACCAGTGTGGAGAAGG + Intergenic
905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG + Exonic
906496085 1:46304912-46304934 CCAAGTGACCAGAGAACAGACGG - Intronic
907145825 1:52230338-52230360 CCCAGTGTGCAGTGCGCAGGTGG + Intronic
908625778 1:66040098-66040120 CTGAGTAACCAGTGTTCAGATGG - Intronic
910070703 1:83209992-83210014 CTCAGTCACCAGCTTGCAGAGGG - Intergenic
910606427 1:89090090-89090112 CACAGTGATCAGAGTGCTGAAGG + Intergenic
912632465 1:111257489-111257511 CCCAGTTACCATGCTGCAGAAGG + Intergenic
913073694 1:115323373-115323395 CCCAAAGACCAGTTGGCAGATGG + Intronic
914914193 1:151808339-151808361 CACAGAAACCAGTGAGCAGACGG + Intronic
915163690 1:153936485-153936507 CCCAGTGAGCCTTGTGCAGCTGG - Intronic
915296754 1:154926735-154926757 CACAGTGACCAGCGTACAGTAGG - Intronic
915496628 1:156286441-156286463 CAAAGAGACCAGTGAGCAGAGGG - Exonic
916602102 1:166303282-166303304 CTCACTGACCAGCGTGGAGAAGG - Intergenic
917691723 1:177476847-177476869 CACAGTGACCAGCTTGCAGGTGG - Intergenic
919426286 1:197435518-197435540 CAGAGTCACCAGTGTGCAAATGG + Exonic
922180649 1:223230506-223230528 TTCAGTGGCCAGTGTGGAGAGGG - Intronic
1062763426 10:44765-44787 CTCAGAGTCCAGTGTGCAGAAGG + Intergenic
1063956471 10:11272068-11272090 CCCAGTGCCCAGTGCCCAGTGGG + Intronic
1064461468 10:15538603-15538625 GCCAGTGAACATTGTGCACATGG + Intronic
1066076629 10:31884655-31884677 TCAAGTGACCAGTGTACAGTGGG - Intronic
1066423052 10:35279495-35279517 CTCATGGAACAGTGTGCAGAGGG + Intronic
1066664832 10:37772421-37772443 CCAAGTGGGCAGTGTGCTGATGG + Intergenic
1067794587 10:49311512-49311534 CCCAGTGAGCAGGGTGCACCAGG + Intronic
1069143868 10:64863915-64863937 CCCAAGGGCCAGGGTGCAGATGG + Intergenic
1069637634 10:69935433-69935455 CCCAGTGACTGCTGTGGAGAGGG - Intronic
1069653207 10:70066549-70066571 CCCAGAGAACCGTTTGCAGAGGG - Intronic
1069685168 10:70313229-70313251 TCCAGTGGCCGGAGTGCAGAAGG - Intronic
1069751282 10:70746837-70746859 CCCGGTGGCAAGTGGGCAGAAGG + Intronic
1070865470 10:79705980-79706002 CCCAGTGACTAGTGTGGACCTGG + Intronic
1070879264 10:79844111-79844133 CCCAGTGACTAGTGTGGACCTGG + Intronic
1071632370 10:87228201-87228223 CCCAGTGACTAGTGTGGACCTGG + Intronic
1071645823 10:87360419-87360441 CCCAGTGACTAGTGTGGACCTGG + Intronic
1071837063 10:89428556-89428578 CCCACTGACCAGTGTAATGATGG - Intergenic
1075833024 10:125427559-125427581 TCCAGCGACCTGTGTGCTGATGG + Intergenic
1075962869 10:126584502-126584524 CCCAGTCCCCAGAGTGCAGATGG - Intronic
1076000145 10:126906832-126906854 CCCCGTGACCACTGTCCAGCTGG - Intronic
1077872210 11:6271518-6271540 GCCAGGGCCCAGTGTGCTGATGG - Exonic
1078464799 11:11542075-11542097 CCCAGTGAGGAGGCTGCAGAGGG + Intronic
1079934211 11:26597360-26597382 CCCAGTGACTAGTGTTCAGCTGG + Intronic
1080634780 11:34114186-34114208 GCCAGTGAGCAGTCTGCACATGG - Intronic
1080919713 11:36696788-36696810 CCCAGTGAAAAGTCTGGAGATGG + Intergenic
1084464217 11:69312944-69312966 CACAGTGACCAGGGCACAGAAGG - Intronic
1084568160 11:69943424-69943446 CCCAGTGGCCTGTGTGAAAATGG + Intergenic
1084933003 11:72571618-72571640 CCCAGGGACCGTTCTGCAGAGGG + Intergenic
1085127525 11:74011760-74011782 GCCTGTGAGCAGTGTGCAGCTGG - Intergenic
1085767373 11:79294977-79294999 CACAGGGATGAGTGTGCAGAGGG - Intronic
1088484598 11:110328577-110328599 CCCAGTGACTAGTGTTCAGCTGG + Intergenic
1090234848 11:125139662-125139684 CCCAGTGACCTGTGTGTTCAAGG - Intergenic
1090789282 11:130076561-130076583 GCCAGTGACCAGTGTGATGGGGG + Intronic
1091342007 11:134823311-134823333 CCCAGGGACAAGGGGGCAGAGGG + Intergenic
1091460539 12:641175-641197 ACCAGTGAGCAGTCTGCACACGG - Intronic
1092070937 12:5630889-5630911 GCCAGTGATCTGTGAGCAGATGG + Intronic
1094296737 12:28915176-28915198 CCCAGTGATCTGGGAGCAGAAGG + Intergenic
1095316270 12:40765810-40765832 CCCAGTGACCTGTATACAGCAGG - Intronic
1096216568 12:49801068-49801090 CCAAGCTACCAGTGAGCAGAGGG + Intronic
1096558636 12:52419707-52419729 CCCAGAGATCAGTGAGCAGGAGG - Intergenic
1099292648 12:80790247-80790269 CCCAGTGACTAGTGTTCAGCTGG - Intergenic
1101837342 12:108304704-108304726 ACCCGTGACCGGTGTGCAGGAGG - Intronic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1103040569 12:117691824-117691846 CCCAGTACCCAGTGTGGGGAGGG - Intronic
1103312188 12:120019452-120019474 ACTAGTGCCCTGTGTGCAGAAGG + Intronic
1103517324 12:121515768-121515790 CCCAGCACCCAGTGTGCAGGCGG - Intronic
1104388816 12:128374450-128374472 CACAGTGAGCACTCTGCAGAGGG + Intronic
1104642736 12:130477880-130477902 CCCTGTGGCCAGAGTGCAGCTGG - Intronic
1105571478 13:21607022-21607044 GCCAGTGACAAATGTGCAGAGGG - Intergenic
1107295089 13:38899551-38899573 GCCACTGATCAGTGTGCAGACGG + Intergenic
1107634533 13:42378874-42378896 GCTAGTGACCAGTGTCCAGGAGG + Intergenic
1107722020 13:43259034-43259056 CCCAGTGCCCAGTGTGTCCAAGG + Intronic
1109032648 13:57212477-57212499 CCAAATGACTAGTGTGTAGAGGG - Intergenic
1109931327 13:69222185-69222207 CCCAGTGACTAGTGTTCAGCTGG - Intergenic
1110137232 13:72082951-72082973 CACAGTGCCCTGTGTTCAGAAGG + Intergenic
1110259264 13:73467077-73467099 CCCAGTGAGCATGGTGCACACGG - Intergenic
1116865027 14:50024944-50024966 CCCAGTTACCAGTGGGTAGAAGG + Intergenic
1118591714 14:67406885-67406907 CCCAGGGACAAGTGTCCAGGTGG - Intronic
1121043888 14:90774096-90774118 TCCAGTGACCATGGTGAAGAGGG - Intronic
1121493460 14:94376377-94376399 CCCTGTGCCCAGTGTGGAGCAGG - Intergenic
1122130162 14:99600411-99600433 ATCAGTGACCATTGAGCAGATGG - Intronic
1122319984 14:100849304-100849326 CACACGGACCAGTGTGCAGAAGG + Intergenic
1122477392 14:102020208-102020230 AACTGTGACCAGTGTCCAGACGG - Intronic
1122741302 14:103872854-103872876 CCCAGGGCCCTGTGTGCAGTGGG + Intergenic
1124955348 15:34356586-34356608 CCCAGTGATCTGTGGGCAGAAGG + Exonic
1125501453 15:40242318-40242340 CACAGTGTCCTGGGTGCAGAAGG + Intronic
1129249327 15:74299982-74300004 CCCACTGGCCAGTGCCCAGAAGG + Intronic
1129776346 15:78239155-78239177 CCCAGTGACTAGCGTTCAGCTGG + Intronic
1129797732 15:78390921-78390943 GCCAGTGGTCAGTGTGGAGAGGG - Intergenic
1130907493 15:88251000-88251022 CCCTGAGCCCAGGGTGCAGATGG + Intronic
1131673880 15:94651312-94651334 CCCAGTGACTAGTGTTCAGCTGG - Intergenic
1132552143 16:557944-557966 CCCACTGCCCATTCTGCAGATGG + Intergenic
1132759473 16:1501790-1501812 CCCAGTGGGCAGCGTGCAGGAGG + Intronic
1134211845 16:12284187-12284209 CCAAGTCACCAGGCTGCAGAAGG - Intronic
1135323770 16:21513196-21513218 AGCAGTGACCAGAGAGCAGAGGG - Intergenic
1136335253 16:29606461-29606483 AGCAGTGACCAGAGAGCAGAGGG - Intergenic
1137013247 16:35344761-35344783 CCCAGTGAACAGTGTGGGCAGGG - Intergenic
1137033192 16:35543966-35543988 CCCAGGGAACAGTGTGGACAGGG - Intergenic
1137679458 16:50327052-50327074 ATCAGTGACCAGTGTGGTGAAGG + Intronic
1138533217 16:57646282-57646304 CCCACTGCCCACCGTGCAGAGGG + Intronic
1139651677 16:68365398-68365420 CCCAGTGACCAGCGTGGCCACGG + Intronic
1141038851 16:80654565-80654587 CCCAGGGCCCTGTATGCAGAGGG - Intronic
1141225859 16:82114327-82114349 CCCACAGACCTGTGAGCAGACGG - Intergenic
1141597351 16:85105410-85105432 GGCAGAGACCAGAGTGCAGAGGG - Exonic
1141699542 16:85636125-85636147 CCCAGTGCCCAGGTTGCAGCTGG - Intronic
1142035978 16:87862303-87862325 AGCAGTGACCAGAGAGCAGAGGG - Intronic
1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG + Intronic
1142475190 17:184526-184548 CACAGTGCCCAGTGTGCAACTGG + Intergenic
1142672867 17:1495323-1495345 CCCCGTGAGGAGTGAGCAGAGGG - Exonic
1144688971 17:17247031-17247053 GCCAGTGACAAGTGTTCGGAGGG - Exonic
1147505967 17:41017909-41017931 CCCAGAGACCTGACTGCAGACGG - Intronic
1149600663 17:57891096-57891118 GCCAGTGTTCAGTATGCAGATGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150655705 17:67038047-67038069 CACGGTGACCAGCGTGCAGAGGG - Intergenic
1151265558 17:72952496-72952518 CCCCATGCCCAGTGAGCAGATGG - Intronic
1151694357 17:75706560-75706582 CCCAGTGACCACTGCCCAGTGGG + Exonic
1152074732 17:78151928-78151950 CACAGAGACCAGTCTGGAGAGGG + Intronic
1152691354 17:81719566-81719588 CCCGGGGTCCAGTGGGCAGAGGG - Intronic
1152892682 17:82891393-82891415 CACAGTGACCAGCATGCGGACGG + Intronic
1152956335 18:45096-45118 CTCAGAGTCCAGTGTGCAGAAGG + Intergenic
1154065399 18:11102657-11102679 CCCAGTGATCTGTCTCCAGAGGG + Intronic
1154165047 18:12008570-12008592 CACAGGGACCAGCCTGCAGAAGG + Intronic
1155489845 18:26389742-26389764 CCCAGTGACCAGAGGGTAGTGGG + Intronic
1155945299 18:31842334-31842356 CCAACTGACCAATGTGCACAGGG + Intronic
1156033910 18:32744890-32744912 GCCAGTGAACAGTGGGCAAACGG + Intronic
1156894080 18:42224575-42224597 CCCAAAGACCAGTCAGCAGAGGG - Intergenic
1158397565 18:57091119-57091141 CCTAGTGAACAGTCAGCAGAAGG + Intergenic
1158996501 18:62925894-62925916 CCCAGTGACTCCAGTGCAGATGG + Intronic
1161142271 19:2654781-2654803 CCCAATGTCCACAGTGCAGAGGG - Intronic
1161858289 19:6778407-6778429 CCCAGTGAATAGTGGGGAGAGGG + Intronic
1163327577 19:16614991-16615013 GCCAGTGACCAGTTTACAAATGG - Intronic
1163832822 19:19555153-19555175 CCCAGTGGCCCGTGGGCACATGG - Intergenic
1164037373 19:21466712-21466734 CCCAGGGAGCAGTGCTCAGATGG - Intronic
1164593322 19:29518012-29518034 CCCAGTGCCCTCTGAGCAGAGGG + Intergenic
1165724091 19:38100595-38100617 CCCAGTCACCAGTGACCAGGGGG + Intronic
1167710763 19:51109079-51109101 CCCTGTGTCTAGGGTGCAGACGG - Intergenic
1168559726 19:57372850-57372872 ACTAGTGAGCAGTGTGTAGAAGG - Intronic
925263453 2:2547695-2547717 GCCAGTGCCCAGAGTGCTGAGGG - Intergenic
926087972 2:10032101-10032123 CCCTGTGGCCAGTCTGCAGCCGG - Intergenic
926762749 2:16293594-16293616 CCCACTGACCTGTGGACAGATGG + Intergenic
930191341 2:48463244-48463266 CCCAGTGATCAGGAGGCAGAGGG + Intronic
931882926 2:66585691-66585713 CCCAGTGTCTGGTGTCCAGAAGG - Intergenic
932801307 2:74744797-74744819 GCCAGTTACCTCTGTGCAGAGGG + Intergenic
932918211 2:75879265-75879287 CCCAGTGACTAGTGTTCAGCTGG - Intergenic
934753840 2:96811419-96811441 CACAGTGACCTCTGTGCACACGG + Exonic
937325551 2:120987940-120987962 CACCGTGCCCAGTGAGCAGATGG - Intronic
937869083 2:126774906-126774928 TCCAGTGAGCTGTGAGCAGAAGG + Intergenic
938139249 2:128782931-128782953 CCTGGTGAGCAGTGTGGAGAGGG - Intergenic
940625037 2:156164275-156164297 TTCAGTAACCAGTGAGCAGAAGG + Intergenic
943685246 2:190811117-190811139 CCCAGTGACCCTGGTGCCGACGG + Intergenic
948064615 2:235067798-235067820 CACAGGTACCAGTGTGCAAAAGG - Intergenic
948300445 2:236902592-236902614 GCCAGTAACCACTGTGCACATGG + Intergenic
948542276 2:238699327-238699349 TCCAGGGACGAGTGTGCAGGAGG - Intergenic
1168730944 20:80182-80204 ACCAGTGATCTGGGTGCAGAAGG + Intergenic
1169793138 20:9432788-9432810 ACCAGTGACCACAGGGCAGAAGG + Intronic
1170640154 20:18144882-18144904 CCCAGTGCCTGGTATGCAGAGGG + Intronic
1170973335 20:21137401-21137423 TCCTGTGACCAGTGTTAAGATGG - Intronic
1172657803 20:36547752-36547774 CACAGCGAGCAGTCTGCAGAGGG + Intronic
1173312410 20:41909745-41909767 CCCAGTGGAGAGAGTGCAGATGG + Intergenic
1173618206 20:44416498-44416520 CACAGTGCCCAGTGCGCAGGAGG + Intronic
1173914366 20:46695911-46695933 CCCAGTGACTAGTGGGTGGAAGG - Intergenic
1174862612 20:54105347-54105369 CCCAGAGGCCAGTGGGAAGATGG - Intergenic
1175440466 20:58987376-58987398 CCCAGTGAGGAGGGAGCAGATGG - Intronic
1176002781 20:62840430-62840452 CCAAGTGAAGAGTGAGCAGATGG + Intronic
1176230675 20:64031177-64031199 CCCAGTGAACACTGAGAAGATGG - Intronic
1177120588 21:17132769-17132791 CCCAGTGATCTGGGTGAAGAAGG + Intergenic
1177856341 21:26404602-26404624 CCCAGTGAGCAGAGAGCAGCAGG - Intergenic
1179784190 21:43720274-43720296 CCCAGTGACCAGGCCGCAGGTGG - Intronic
1180869389 22:19137807-19137829 CACAGAGGCCAGAGTGCAGAGGG + Intronic
1180959022 22:19754390-19754412 CCCTGGGACCAGGGAGCAGATGG + Intergenic
1181339417 22:22166140-22166162 CCCAGTGAGCAGGGGACAGAGGG - Intergenic
1181761155 22:25059708-25059730 CCCAGGTACCAGTCTGCACAAGG + Intronic
1182416237 22:30223166-30223188 CCCAGCGTCCAGTGGGAAGACGG - Intergenic
1182506011 22:30783138-30783160 CCCAGGAACCTGTGTGCATATGG + Intronic
1183083212 22:35470383-35470405 CCCAGGCACCAGTGTCCAGATGG - Intergenic
1184479067 22:44736688-44736710 CCCAGTGTGCAGTGAGCAGCAGG + Intronic
1184650423 22:45917071-45917093 CACAGTGCCCAGTGGGCAGGTGG - Intergenic
1184869118 22:47222357-47222379 CCCATTGTCCAGTGAGAAGAGGG + Intergenic
1184939826 22:47755605-47755627 CCTAGAGTCCAGGGTGCAGACGG - Intergenic
1185258898 22:49850617-49850639 CCCAGTGACCAGTGGTCACCGGG + Intergenic
950714333 3:14837033-14837055 CACAGTGACCAGACTGCAGCAGG + Intronic
950728452 3:14935172-14935194 CTCTGTGCCCAGTGAGCAGAGGG - Intergenic
953505927 3:43485422-43485444 CCCAGTGACTAGTGTTGAGCTGG - Intronic
954755668 3:52838198-52838220 CCCACTTCCCAGTGAGCAGAGGG - Exonic
955820344 3:62889797-62889819 CCAAGAGTCCAGTGTGCAGGAGG + Intergenic
957200147 3:77124089-77124111 CCCAGTGCCCAGTGTCTAGATGG + Intronic
957245658 3:77712612-77712634 ACCAGGGACCAGACTGCAGAGGG + Intergenic
957275403 3:78084808-78084830 CACAGGGACCAGTGTTTAGAAGG - Intergenic
958722699 3:97864475-97864497 CCCAGTGACCATCATGAAGACGG + Exonic
958753638 3:98223917-98223939 CACAGTGCCCAGTGAGTAGAGGG + Intergenic
961387408 3:126530282-126530304 CCCAGGGGCCAGTGGGTAGAAGG - Intronic
961445461 3:126978955-126978977 CCCAGTGACCAGGGATCTGAGGG + Intergenic
961519133 3:127456707-127456729 CCCGGGGAACAATGTGCAGAAGG + Intergenic
962317260 3:134366721-134366743 CCCTGTGCCCAGTGTCCAGAAGG + Intronic
962894828 3:139704768-139704790 CCCAGTGGCCAGGATGAAGAGGG + Intergenic
967100771 3:186213761-186213783 CCAAGTGATCATTATGCAGATGG + Intronic
967976604 3:195038779-195038801 CCCAGTGACCAATGCTCTGATGG - Intergenic
968357998 3:198123148-198123170 CTCAGAGTCCAGTGTGCAGAAGG - Intergenic
969061484 4:4438743-4438765 CACAGTGACCAGCATGCAGGGGG + Intronic
969341897 4:6547453-6547475 CCCAGTGTCCAGTGTTCCCACGG - Intronic
971915538 4:32866042-32866064 CCAATAGACCAGGGTGCAGAGGG + Intergenic
971995076 4:33954995-33955017 CCCAGTGATCTGAATGCAGAAGG - Intergenic
971995294 4:33956454-33956476 CTCAGTGATCTGGGTGCAGAAGG - Intergenic
974908213 4:68082920-68082942 CCCAGTGATCTGGGTACAGAAGG + Intronic
976705639 4:88016202-88016224 CCCAGTCCCCAGGCTGCAGACGG - Intronic
978932147 4:114327739-114327761 CACAGTGTCCAGTCTGCAGGTGG + Intergenic
981474248 4:145172265-145172287 GGTAGTGACCAGTGTGTAGAAGG + Intronic
981823774 4:148915763-148915785 CCCAGCGACTAGTGTTCAGCTGG - Intergenic
983690658 4:170465274-170465296 CCCAGTGATCTGGGTGTAGAAGG - Intergenic
985707469 5:1409846-1409868 CCCTGTGCTCTGTGTGCAGATGG - Exonic
985993486 5:3583140-3583162 CTCAGGGACCAGTGAGCAGTAGG - Intergenic
987061357 5:14246928-14246950 CTCAGTGAGCAGGGTGGAGAGGG - Intronic
987837794 5:23183586-23183608 GGAAGAGACCAGTGTGCAGAGGG + Intergenic
990174503 5:53092058-53092080 CCCAGTCACTAGGATGCAGATGG + Exonic
990267688 5:54095771-54095793 CCCAGTTGCCATTTTGCAGATGG - Intronic
991369432 5:65902905-65902927 CACAGTCTCCAGTTTGCAGATGG + Intergenic
992155678 5:73953055-73953077 GCCAGTGACAAGTCTGCTGATGG + Intergenic
993004480 5:82415748-82415770 CCCAGTGACCTGTCCTCAGAAGG - Intergenic
995178546 5:109207931-109207953 CACAATGACCTGTGTGCAAAAGG + Intergenic
995466183 5:112451266-112451288 CCCAGTGACTAATGTTCAGCTGG - Intergenic
996939783 5:128990769-128990791 CCCAGCGACTAGTGTTCAGCTGG + Intronic
997266987 5:132500744-132500766 CCCAGCCTCCAGTGTGCAGAAGG - Intergenic
998141768 5:139703894-139703916 CCCAGTGTGCTGTGTGTAGATGG + Intergenic
998554586 5:143110821-143110843 CCCAGTCCACAGGGTGCAGATGG - Intronic
998870176 5:146544031-146544053 CCCAGTGACCCTGATGCAGAGGG + Intergenic
1003394221 6:5739552-5739574 CCCAGTGGCCTGTGTGTAGGAGG + Intronic
1005523413 6:26621426-26621448 TCCAGTGAACAGTTTGCAAATGG - Intergenic
1005989289 6:30893191-30893213 CCCAGGGAGAAGGGTGCAGAGGG - Intronic
1006221402 6:32495144-32495166 CCCAATGAGCAGTGTGTGGAGGG - Intergenic
1007702162 6:43771697-43771719 GCCAGAGACCAGTGGGCAGGGGG + Intronic
1015658548 6:135546902-135546924 CCCTGTGACCAATGGGCGGAGGG + Intergenic
1018953926 6:168395447-168395469 CCCTCTTCCCAGTGTGCAGATGG - Intergenic
1019326257 7:439767-439789 CCCACTGCTCAGTCTGCAGATGG + Intergenic
1019854773 7:3593697-3593719 GCCAGTGGCCAGTGAGCAGGAGG - Intronic
1020469207 7:8516843-8516865 GCCAATGCCCAGGGTGCAGAAGG + Intronic
1021616679 7:22509002-22509024 CCAATTGACCACTGTGCAGGAGG + Intronic
1021920835 7:25483385-25483407 CACAGGGACCAGAGAGCAGATGG + Intergenic
1022626386 7:32041041-32041063 TTCAGTGACCACTATGCAGAAGG - Intronic
1022926483 7:35060206-35060228 CCAATTGACCACTGTGCAGGAGG + Intergenic
1026010120 7:66629439-66629461 CCCAGTGACTACTGGGCGGAGGG - Intronic
1026977232 7:74506280-74506302 ACCAGTGCCCAGTGTGCATAAGG - Intronic
1027045064 7:74985707-74985729 CTCAGTGTCCCGTCTGCAGAGGG + Intronic
1027288424 7:76674863-76674885 CTCAGTCACCAGCTTGCAGAGGG - Intergenic
1028375783 7:90145338-90145360 CCAATTGACCACTGTGCAGGAGG - Intergenic
1029387792 7:100255203-100255225 CTCAGTGTCCCGTCTGCAGAGGG - Intronic
1029824489 7:103174900-103174922 CCAATTGACCACTGTGCAGGAGG + Intergenic
1031948286 7:127864340-127864362 CCCAGTGACCAGTGTAGAGATGG - Intronic
1035016430 7:155770348-155770370 CACAATGACCTGTGTGTAGAGGG + Intronic
1035307828 7:157944700-157944722 GCCAGTGACCACTGTCCAGCAGG + Intronic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1036208777 8:6825315-6825337 TGCACTGACCAGTCTGCAGAAGG - Exonic
1036217928 8:6896406-6896428 ACCAGAGAACAGTGTGGAGAAGG + Intergenic
1036732097 8:11274954-11274976 TCCAGTGGCCAGTGTGGATAGGG + Intergenic
1037498591 8:19464034-19464056 CCCACTGACATGCGTGCAGACGG + Intronic
1040811752 8:51461390-51461412 CCCAGCGATCTGGGTGCAGAAGG + Intronic
1041102723 8:54412715-54412737 CCCACTGACAGGTGTGCAAATGG + Intergenic
1042004878 8:64169253-64169275 ACCAGTGCCCAGAGTCCAGAAGG - Intergenic
1044051373 8:87509887-87509909 CCAAGTCTCCAGTTTGCAGATGG + Intronic
1044587084 8:93877890-93877912 CCCAGTGGGGAGTTTGCAGAAGG + Intronic
1045051768 8:98333910-98333932 CCAGGTCTCCAGTGTGCAGATGG + Intergenic
1048037729 8:130693340-130693362 CCCAGCAACCTGGGTGCAGATGG - Intergenic
1048499231 8:134960691-134960713 CACAATGCCCAGTGTGCAGTAGG - Intergenic
1048832695 8:138492106-138492128 CCCAGTGTCTACTGTGCACAAGG - Intronic
1050116026 9:2264433-2264455 CCTAGTGACTAGTGTTCAGCTGG + Intergenic
1050617082 9:7412828-7412850 CCCATTGAAAAGTGTGCAAAGGG + Intergenic
1053125569 9:35578029-35578051 CCCAGGGACCAGTGAGTCGAGGG - Intergenic
1056022433 9:82453855-82453877 CCAAGGGACCATTTTGCAGAAGG + Intergenic
1056654173 9:88495667-88495689 CCCACAGACCAGAGTGCAAAAGG + Intergenic
1057228498 9:93304871-93304893 CCCAGTGACCAGTGTGCAGACGG - Intronic
1057355150 9:94325974-94325996 CCCAGTGACTAGTGTGGACCTGG - Intronic
1057548254 9:96034025-96034047 CCCAGTGACCGGAGAGCAGCGGG - Intergenic
1057695939 9:97323109-97323131 CCCAGAGACCAGTGAGCACCAGG - Intronic
1057886647 9:98834680-98834702 CTCAGAGGCCAGTATGCAGAAGG - Intronic
1058954671 9:109934541-109934563 CCAAGTGAAGAGCGTGCAGAGGG - Intronic
1060930431 9:127486370-127486392 CACAGTGCCCAGTGAGCACAGGG - Intronic
1061003691 9:127916703-127916725 CCCAATTCCCAGTGCGCAGATGG + Intronic
1062209115 9:135353679-135353701 CCCAGGGAGCAGTGAGCAGGAGG + Intergenic
1062311442 9:135939811-135939833 ACCAGTGACCTGCGTGCAGAGGG + Intronic
1187152394 X:16693243-16693265 GCTAGTGTCCAGTGTGCTGACGG - Intronic
1187451578 X:19401516-19401538 CCCCAAGACCAGTGTTCAGAGGG + Intronic
1187613850 X:20972028-20972050 CCCAGTGACTAGTGTTCAGCTGG - Intergenic
1188524713 X:31076253-31076275 CCCAGAAACCAGTGTGTAGCTGG + Intergenic
1194374322 X:93113015-93113037 CCCAGTGAGCTTGGTGCAGAAGG - Intergenic
1195742143 X:108075652-108075674 CCCAGTGACCAGAGTGCATGAGG + Intronic
1196287247 X:113897297-113897319 CCCAGTGACTAGTGTTCAGCTGG + Intergenic
1196768398 X:119270408-119270430 TCCTGGGTCCAGTGTGCAGAAGG - Intergenic
1197600074 X:128518125-128518147 CCCAGTGATCTGGGTGCAGAAGG + Intergenic
1199182012 X:144868680-144868702 CCCATTAAACAGTGTGCAAATGG - Intergenic