ID: 1057228799

View in Genome Browser
Species Human (GRCh38)
Location 9:93306383-93306405
Sequence GGCAGGACACCCTGCTGAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057228799_1057228809 23 Left 1057228799 9:93306383-93306405 CCGACTCAGCAGGGTGTCCTGCC 0: 1
1: 0
2: 4
3: 9
4: 182
Right 1057228809 9:93306429-93306451 CCTGATGTTTGAAAGCCAAGCGG No data
1057228799_1057228802 -10 Left 1057228799 9:93306383-93306405 CCGACTCAGCAGGGTGTCCTGCC 0: 1
1: 0
2: 4
3: 9
4: 182
Right 1057228802 9:93306396-93306418 GTGTCCTGCCTCCATCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057228799 Original CRISPR GGCAGGACACCCTGCTGAGT CGG (reversed) Intronic
900098296 1:949327-949349 GGCAGCCACCCCTGCTGAGTGGG - Intronic
900164201 1:1238164-1238186 GGCAGGAGGCCCTGCTGGGCTGG + Intergenic
900397256 1:2458175-2458197 GGCAGGACACCGGGCTGCCTGGG + Intronic
901229869 1:7635694-7635716 TGCAGGCCGCCCTGCTGAGCTGG + Intronic
901401405 1:9017414-9017436 GGCAGGACCCTCTGCAGAATAGG - Intronic
901952330 1:12759004-12759026 GCCAGGACATCCTGCTGAATGGG - Intronic
902797459 1:18808744-18808766 GGCAGGACCCCAGGCAGAGTCGG + Intergenic
904374132 1:30069172-30069194 GGCAGGAGATGCTGCTGAGGGGG + Intergenic
906557218 1:46723333-46723355 TGCATGGCACCCTTCTGAGTGGG + Intergenic
907329923 1:53664059-53664081 GGCCAGACTCCCTGCAGAGTGGG - Intronic
907722669 1:56986743-56986765 GGGAGGACATCCTGCTGCATTGG - Intergenic
913165526 1:116181290-116181312 GGCAGGACTCCCTGGTGTGATGG - Intergenic
916582359 1:166120417-166120439 TGCTGGGCACCCTGCTAAGTAGG - Intronic
917056901 1:170992635-170992657 GGCAGGCCTCTCTGCTGAGCTGG + Intronic
918250834 1:182701676-182701698 AGCAGGACCCCCAGCTAAGTAGG + Intergenic
921656297 1:217742319-217742341 GGCAGATCACACTGCTGACTTGG - Intronic
921675266 1:217969002-217969024 GGCAGGTCATCCTGATGAGTTGG - Intergenic
923497224 1:234536136-234536158 TTCAAGACACCCTGCTGAATTGG - Intergenic
924123829 1:240829294-240829316 GGAAGGGCACCCAGCTGGGTGGG + Intronic
1065265097 10:23966429-23966451 GGCAGCCCACCCTGGTGGGTTGG - Intronic
1070657860 10:78283488-78283510 GGCAGGACAACCAGTGGAGTGGG - Intergenic
1070764553 10:79048853-79048875 GTCAGGACACAATGCTGAGTTGG + Intergenic
1071464557 10:85927394-85927416 GGCAGAAGACCCTGTTGACTGGG - Intronic
1072030733 10:91519812-91519834 GGCAGGAGACTCAGCTAAGTTGG - Intergenic
1072566063 10:96617703-96617725 AGCAGGACACACCGCTGACTGGG + Intronic
1073353565 10:102836488-102836510 GGCTGGGGGCCCTGCTGAGTGGG + Intronic
1073475435 10:103749508-103749530 GGCAGGAAAGACAGCTGAGTTGG - Intronic
1075709970 10:124525707-124525729 GGCAGGAAACCCAGCAGAGGAGG - Intronic
1076648794 10:131972824-131972846 GGCTGGACACTCAGCTGAGCGGG - Intronic
1077131086 11:973052-973074 TCCAGGATACCCTGCGGAGTTGG + Intronic
1077443926 11:2581463-2581485 GGGAGGACACCCTGCAGACGAGG + Intronic
1078600307 11:12724711-12724733 GGCAGAACCTCCTGCTCAGTGGG + Intronic
1083709877 11:64541354-64541376 GGCAGGGCACCCTGCAGAGTAGG - Intergenic
1084272541 11:68036912-68036934 GCCAGGACACCCGGGAGAGTGGG - Intergenic
1084542737 11:69797576-69797598 TGCAGGAGAGGCTGCTGAGTAGG - Intergenic
1085713773 11:78853960-78853982 GGCACGAGACCCTCCTGACTGGG - Intronic
1087225331 11:95592525-95592547 GCCCTGACACTCTGCTGAGTTGG - Intergenic
1091275107 11:134344708-134344730 GGCCGGACCCCATGCAGAGTCGG - Intronic
1091623514 12:2106500-2106522 TTCAGGACACCCAGCTGAGGTGG - Intronic
1096077046 12:48812498-48812520 GGCAGGGCACCCTGCTGAGAGGG - Intergenic
1101907153 12:108835667-108835689 GGCAGGGCAAGCTTCTGAGTTGG + Intronic
1103950263 12:124546819-124546841 GGCAGGACCGTCTGCAGAGTGGG - Intronic
1105243774 13:18629206-18629228 AGCAGGACATCCTCCTGACTTGG + Intergenic
1106683303 13:32030875-32030897 GACAGTACACACTGCTTAGTTGG - Intergenic
1106840383 13:33680370-33680392 GGCAGCACACACTGCTGGGAAGG + Intergenic
1113104049 13:106753427-106753449 GGCAGGTCACGCTGCTCACTTGG + Intergenic
1113560046 13:111271456-111271478 AGCAGGACACCTTGCTGTGCAGG + Intronic
1113796090 13:113059373-113059395 GGCAGGACATCCTGGTGAGTCGG + Intronic
1114673776 14:24428411-24428433 GGAAGCAGAGCCTGCTGAGTGGG + Intronic
1120681276 14:87483886-87483908 GGCAGTAGAGCCTCCTGAGTGGG - Intergenic
1121838897 14:97116566-97116588 GCCATGACACCCTGTTGACTTGG + Intergenic
1122265570 14:100545127-100545149 GGCCGCACAGCCTGCTGAGCAGG + Intronic
1122345884 14:101059927-101059949 GCCAGGGCACACTGCTGGGTCGG - Intergenic
1122834799 14:104425390-104425412 GGCAGGACACCCTGCAGCACCGG + Intergenic
1124452204 15:29805266-29805288 GGCAGGAAGCCCTTCAGAGTTGG - Intronic
1128114055 15:65094456-65094478 GGCAGGAAGCCCTGCTGACCTGG + Exonic
1130033258 15:80334697-80334719 GGCAGGTTACCCTTCTGAGAAGG + Intergenic
1132585359 16:703813-703835 AGCTGGACACCCTGGGGAGTGGG + Intronic
1133040262 16:3056916-3056938 AGCAGGACACCCTCCAGAGGTGG - Intronic
1138598120 16:58040234-58040256 GCAACAACACCCTGCTGAGTGGG + Intronic
1139481712 16:67234348-67234370 GGGTGGACACCCAGGTGAGTAGG - Exonic
1139697031 16:68682375-68682397 GGCACGCCACGCTGGTGAGTTGG - Exonic
1139923616 16:70474139-70474161 GGCAGGAGACCCTGGTGTGGCGG + Exonic
1140730587 16:77852364-77852386 GTCAGGAAACCCAGCTGAGGGGG + Intronic
1141148347 16:81547516-81547538 GGCTGGACACCTTGCTCAGAGGG + Intronic
1141913653 16:87077885-87077907 GGGGGGACACCCTGCTGTGGAGG + Intergenic
1141913660 16:87077903-87077925 GGAGGGACACCCTGCTGTGGGGG + Intergenic
1141913667 16:87077921-87077943 GGGGGGACACCCTGCTGTGGGGG + Intergenic
1141913674 16:87077939-87077961 GGGGGGACACCCTGCTGTGGGGG + Intergenic
1142075102 16:88113479-88113501 GACAGGAGAGCCTGCTGAGCAGG + Intronic
1143636628 17:8167605-8167627 TCCAGGACACCATGCAGAGTGGG - Intergenic
1146273322 17:31498482-31498504 GGCAGGAGGCCCTGCAGGGTTGG + Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147870190 17:43581756-43581778 GACAGGACACCCTGCTGGGTGGG + Intergenic
1148468324 17:47878024-47878046 GGAAGGACACCCTGTTTTGTTGG - Intergenic
1148873425 17:50672427-50672449 GGCAGGACACCAAGCTGGGCAGG + Intronic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151494224 17:74449874-74449896 GGCAGGAGGCCCTGGTGAGAAGG - Intronic
1151940250 17:77287552-77287574 GCCAGGCCACCCTGCAGAGCTGG - Intronic
1153771057 18:8416722-8416744 GGCAGGATACCTTTCTGAGTTGG - Intergenic
1160810952 19:1012734-1012756 GGCAGGACACCAGCTTGAGTGGG - Intronic
1161249942 19:3275251-3275273 GGCTGGACCCCCTGCTGGGTGGG - Intronic
1163694425 19:18756698-18756720 GGCAGAACATCCAGCTGTGTGGG - Intronic
1164577302 19:29413063-29413085 AGCAGGTCACCCTGCTAGGTTGG - Intergenic
1165427083 19:35752274-35752296 GGCCGGGCACCCTGGTGGGTTGG + Intronic
1166738693 19:45101360-45101382 GGCAGGAGAGACTGCTGTGTGGG + Intronic
1167610527 19:50505904-50505926 GGCCAGACACCCTGGTGTGTGGG - Intergenic
925003691 2:426137-426159 GGCACGGCGCCCTGCTGAGTGGG - Intergenic
925108349 2:1312284-1312306 GGCAGGAGACCCGCCTGCGTGGG - Intronic
925979998 2:9169028-9169050 CCCAGGAGACCTTGCTGAGTTGG - Intergenic
927074104 2:19559788-19559810 GGCAGGAAACGCTGCTGATGTGG - Intergenic
927667607 2:25042905-25042927 GGGAGGAGACGCTGCTGAGAGGG + Intronic
928099915 2:28430942-28430964 GCCAGGAAGCCCTGCTGAGAAGG - Intergenic
930028535 2:47044469-47044491 GGCAGGACACAGCCCTGAGTAGG - Intronic
931484131 2:62672876-62672898 GGCAGGACACATTCCTGACTGGG + Intergenic
932438476 2:71717055-71717077 GACAGGACAGGCTGCTGAGGGGG - Intergenic
932830028 2:74980408-74980430 GGCAGGACACTCTGCTTTCTTGG + Intergenic
936983194 2:118283391-118283413 GGCAGGACACCCTGGGGAAGAGG + Intergenic
939801757 2:146720205-146720227 AGCAGCAGACCCTACTGAGTTGG + Intergenic
942133924 2:172906751-172906773 GGCAGGACTCCCTACTGTGGAGG - Intronic
946178734 2:217937551-217937573 GGCAGGAAGTCCTGCTGATTAGG - Intronic
947463755 2:230324027-230324049 AGCAGGGGACCCTGGTGAGTGGG + Intergenic
947472576 2:230412467-230412489 AGCAGGGGACCCTGGTGAGTGGG + Intergenic
948864135 2:240766973-240766995 GGCAGGACATTGTTCTGAGTGGG - Exonic
1170447422 20:16442929-16442951 GGCAAGGCACGCTGGTGAGTAGG + Intronic
1172176259 20:32973716-32973738 GGCAGGATAGCCTGCTGGTTAGG - Intergenic
1172885482 20:38228138-38228160 TGCAGGCCACCCAGGTGAGTGGG - Exonic
1173959157 20:47057851-47057873 GGCAGGACGGCCTGCTGGCTGGG + Intronic
1177498359 21:21918156-21918178 GGCAGGAGGCTCAGCTGAGTCGG + Intergenic
1177655503 21:24011356-24011378 GACATGACTCCCTCCTGAGTGGG - Intergenic
1180142418 21:45900474-45900496 GGCAGGAGGCTCTGCTGTGTGGG + Intronic
1181236273 22:21449613-21449635 TGCTGGAAACCCTTCTGAGTTGG + Exonic
1182013829 22:27022560-27022582 GTCAGGCCACCCTCCTGGGTGGG + Intergenic
1182491842 22:30677790-30677812 GGCAGCACTGCCTGCTGAGGCGG + Intergenic
1182763896 22:32744809-32744831 GTCAGACCACCCTGCTGCGTGGG - Intronic
1183695887 22:39421958-39421980 GGCAGGCCAACCAGGTGAGTTGG + Exonic
1184194550 22:42918127-42918149 GGCATGACCCCATCCTGAGTAGG + Intronic
1184391607 22:44206478-44206500 GGGAGGACACCCTGCAGCCTCGG - Exonic
1185129874 22:49032859-49032881 GGCAGGTCACACCGCTCAGTGGG - Intergenic
950517425 3:13476496-13476518 GGTGGGAAACCCTGGTGAGTGGG - Intergenic
953044404 3:39281813-39281835 GACAGGACAGCCAGGTGAGTTGG - Intergenic
954456629 3:50603152-50603174 GGCTGGACACACAGCTGAGTGGG - Intergenic
954604081 3:51895250-51895272 GGCGGGGCACCCTGGTGCGTCGG - Exonic
961613437 3:128159780-128159802 GGCAGGAGAGGCTGCTGAGGAGG - Intronic
968605428 4:1532973-1532995 GGCAGGACCCCTTGGTGACTAGG - Intergenic
968944567 4:3656827-3656849 GGCAGGACACCCTGCAGGGAGGG + Intergenic
976502891 4:85812866-85812888 GGCAGGTGACCCTGGAGAGTAGG - Intronic
977971380 4:103217904-103217926 GGCAGGAGACCCTGGTCAGGAGG - Intergenic
978061340 4:104344479-104344501 AGCACCACACCCTACTGAGTTGG + Intergenic
983311695 4:166072263-166072285 GGCAGGAAACTCTGATAAGTTGG + Intronic
984577894 4:181472649-181472671 GGCAGGAAATCCTCCTGACTTGG + Intergenic
987134063 5:14884705-14884727 GGGAGGTCACTCTGTTGAGTAGG + Intergenic
987201431 5:15581632-15581654 ATCAGGACAGTCTGCTGAGTAGG - Intronic
987923356 5:24311205-24311227 GGCAGCACTGCCTGCTGAGGAGG + Intergenic
995047986 5:107671499-107671521 GGCAGGTCCCCCAGCAGAGTCGG + Intergenic
997423458 5:133787164-133787186 AACAGGACACCCTGTTGTGTGGG + Intergenic
997582271 5:135025413-135025435 TTCAGGACACCCTGCAGAGGTGG + Intergenic
997813541 5:136995119-136995141 AGCACGACACCCTGCTGCGGTGG - Intronic
1000042411 5:157494594-157494616 GGCCAGTCACACTGCTGAGTTGG + Intronic
1000300872 5:159954873-159954895 TGTAGGACACCCAGCTGGGTGGG - Intronic
1000731836 5:164844336-164844358 GGCATGAAAACCTGCTGACTTGG + Intergenic
1001217793 5:169871995-169872017 AGCAGGACCCACTGCTGAGAAGG - Intronic
1001836250 5:174835241-174835263 GGCAGGATACCATGCGGATTGGG - Intergenic
1002856060 6:1039323-1039345 GGCAGCACACCTTGGTGTGTGGG - Intergenic
1003396071 6:5752953-5752975 GCCAGTTCACCCTGCTGGGTGGG - Intronic
1004321159 6:14632748-14632770 GGCAGGACACAGAGCTGAGGAGG + Intergenic
1005864705 6:29928632-29928654 GGCAGGACACACTTCTAACTGGG - Intergenic
1006439410 6:34043786-34043808 GGCAGGTTACCCTGGTGAGGGGG - Intronic
1011928542 6:92679244-92679266 GAAAGGACAGCCTGCTGACTGGG + Intergenic
1012496662 6:99841200-99841222 AGGAGGACTCCCTGCTGAGGGGG + Intergenic
1017788211 6:157773747-157773769 GGCAGGATAAGGTGCTGAGTTGG + Intronic
1019868607 7:3737188-3737210 GACAGGACCCCCTGCTGGGCAGG + Intronic
1021030959 7:15735214-15735236 GGCTGGCCACCCTGCAGACTGGG + Intergenic
1021913165 7:25406298-25406320 CTCAGGACAACCTGATGAGTAGG - Intergenic
1021925383 7:25529426-25529448 TGCAGGCCTCCCTGCTGCGTTGG + Intergenic
1023936008 7:44740191-44740213 GGCAAGTCACCCTGCTGGGAAGG + Intergenic
1025075195 7:55936668-55936690 GCCAGGAGAAGCTGCTGAGTTGG + Intronic
1028357093 7:89923628-89923650 TGCGGGAGACACTGCTGAGTGGG - Intergenic
1029729337 7:102429301-102429323 AGCAGCACAGCCTGCTGTGTGGG + Intergenic
1030737356 7:113065364-113065386 GGCAGGACAGCATGGTGAGCAGG + Intergenic
1032436908 7:131908263-131908285 GGCAGGTGCCCCTGCTGAGGAGG + Intergenic
1033085869 7:138341315-138341337 GGCAGCACTGCCTGCTGAGGTGG - Intergenic
1034980071 7:155470067-155470089 GGCAGAACACCTTGCTTATTTGG - Intergenic
1035559679 8:594974-594996 TGGAGGACACCTTGCTGAGAGGG + Intergenic
1035814770 8:2527458-2527480 GTCATGATACCCTTCTGAGTGGG - Intergenic
1038724637 8:30069667-30069689 GGGAGGAGGTCCTGCTGAGTTGG + Exonic
1040672014 8:49703363-49703385 GGCAGGACATCATGCTGCCTAGG + Intergenic
1045462375 8:102436876-102436898 TTCAGGACATACTGCTGAGTTGG - Intergenic
1050693966 9:8259219-8259241 GGCAGAGCACCCAGCTGAGCTGG - Intergenic
1053103548 9:35391331-35391353 GGCAGGAAACGCTGCTAAATAGG - Intronic
1053707795 9:40771855-40771877 GGCAGTATAACCTGCTGATTTGG - Intergenic
1057228799 9:93306383-93306405 GGCAGGACACCCTGCTGAGTCGG - Intronic
1060221302 9:121765454-121765476 TGCAGGAGAGCCTGCTGAGCAGG + Intronic
1060781379 9:126415881-126415903 GTCAGGCCACCCTTCTGAGGAGG - Intronic
1061149744 9:128821901-128821923 GGGAGGAGACTCTGCTGAGGGGG + Exonic
1062533107 9:137010387-137010409 GGCAGGATGCCCCGCTGAGTGGG - Intronic
1186686738 X:11932843-11932865 GACAGGCCACTCTGGTGAGTGGG - Intergenic
1187349819 X:18502774-18502796 GGCAGGATGCCCTACTGAATAGG - Intronic
1187531085 X:20097607-20097629 GGCTGGACAGCCTCCTGAATAGG + Intronic
1189258165 X:39656504-39656526 CCCAGGACTCCCTCCTGAGTCGG + Intergenic
1195864037 X:109410088-109410110 AGCAAAACACCCAGCTGAGTCGG + Intronic
1196438484 X:115695535-115695557 GGCAGGACATTCTGAGGAGTTGG + Intergenic
1200337990 X:155372417-155372439 TCCAAGACACCGTGCTGAGTTGG + Intergenic
1200348479 X:155468277-155468299 TCCAAGACACCGTGCTGAGTTGG - Intergenic
1201898752 Y:19024096-19024118 GACAGCACAGACTGCTGAGTGGG - Intergenic