ID: 1057228885

View in Genome Browser
Species Human (GRCh38)
Location 9:93306889-93306911
Sequence TCAGGGTTCCCGCGGCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057228875_1057228885 23 Left 1057228875 9:93306843-93306865 CCTTTGTCCTCTCTCATCGCATG 0: 1
1: 0
2: 1
3: 9
4: 169
Right 1057228885 9:93306889-93306911 TCAGGGTTCCCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 97
1057228878_1057228885 16 Left 1057228878 9:93306850-93306872 CCTCTCTCATCGCATGGGCTTTC 0: 1
1: 0
2: 1
3: 7
4: 131
Right 1057228885 9:93306889-93306911 TCAGGGTTCCCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 97
1057228874_1057228885 24 Left 1057228874 9:93306842-93306864 CCCTTTGTCCTCTCTCATCGCAT 0: 1
1: 0
2: 0
3: 17
4: 228
Right 1057228885 9:93306889-93306911 TCAGGGTTCCCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 97
1057228873_1057228885 25 Left 1057228873 9:93306841-93306863 CCCCTTTGTCCTCTCTCATCGCA 0: 1
1: 0
2: 1
3: 14
4: 252
Right 1057228885 9:93306889-93306911 TCAGGGTTCCCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057228885 Original CRISPR TCAGGGTTCCCGCGGCCGGG CGG Intronic
901049980 1:6421039-6421061 TCAGGGTTCTCGCCGCAGGGTGG + Intronic
901317330 1:8318008-8318030 TCTGGGGCCCCGCGGGCGGGAGG - Intronic
902920827 1:19665259-19665281 GCAGGCTCCCCGCGGCCGGTGGG - Intergenic
904080958 1:27872445-27872467 GCAGGGCTCCCGCGGGCTGGCGG + Intergenic
904814128 1:33182256-33182278 TTAGGGTCCCCGCGGCGAGGCGG + Intergenic
905202078 1:36322315-36322337 CCAGGGTGCCCGTGGCCGTGGGG + Exonic
920079482 1:203361944-203361966 TCAAGGTTCCCTCGACCTGGTGG - Intergenic
920211679 1:204333094-204333116 GCAGGGTGCCCGAGGCCTGGGGG - Intronic
921671099 1:217925040-217925062 TCCGTGTGCCCGCGGCCGGCGGG + Intergenic
922669020 1:227494913-227494935 CCAGGGATCCAGCGGCCTGGGGG - Intergenic
922670577 1:227506389-227506411 CCAGGGATCCAGCGGCCTGGGGG + Intergenic
1064380733 10:14838898-14838920 TCAGGATTCCCGCGGGTGGGAGG + Intronic
1066174410 10:32888435-32888457 TCAGGGTGCCCGCTGCTGGTTGG - Intergenic
1067929249 10:50543538-50543560 TCAGGGTTCCCTTGGCCTGCAGG - Intronic
1069738548 10:70672969-70672991 GCAGGGTTCCCGCGGGTGGGAGG + Intronic
1069760721 10:70809322-70809344 TCAGGGTAGCCGGGGGCGGGGGG - Intergenic
1070314186 10:75295093-75295115 ACAGGGCTGCGGCGGCCGGGAGG + Intergenic
1073465636 10:103693237-103693259 GCAGGGGGCCCGCGGGCGGGCGG - Intronic
1076850187 10:133088732-133088754 TCAGGGTGACCGCGGCGGGGCGG - Exonic
1077059716 11:612789-612811 CCAGGGTTCCAGCTGCCAGGAGG + Exonic
1077076922 11:706187-706209 CCAGGTCTCCCGCGGGCGGGTGG - Exonic
1081541470 11:44037591-44037613 TCAGGGTGCCCGCAGCAGAGAGG + Intergenic
1088135558 11:106552267-106552289 TCAGGGTTCCTGCACCTGGGAGG - Intergenic
1089432594 11:118436383-118436405 GCAGGGTGCAGGCGGCCGGGCGG + Intergenic
1089972320 11:122704046-122704068 TCAGGGTGCCTGCGGCGGTGGGG + Intronic
1096773764 12:53951996-53952018 TCTGGGTCCCCGGGGCCGGCGGG - Intergenic
1097725175 12:63067010-63067032 TCCAGGTTCCCGCAGCTGGGAGG - Intergenic
1098288563 12:68933353-68933375 TGCTGGTGCCCGCGGCCGGGCGG + Intronic
1106109056 13:26760857-26760879 GCGGGGATCCCGCGGGCGGGCGG - Intergenic
1109800595 13:67372416-67372438 TCACAGTTCCCGTGGCAGGGAGG - Intergenic
1113489055 13:110677546-110677568 TCTGGGTTTCCGTGGCGGGGTGG - Intronic
1113489088 13:110677693-110677715 TCTGGGTTTCCGTGGCGGGGTGG - Intronic
1113489096 13:110677719-110677741 TCTGGGTTTCCGTGGCGGGGTGG - Intronic
1115769429 14:36655134-36655156 CCAGGAGTCCCGCGGCCGAGCGG - Intergenic
1117325789 14:54667912-54667934 TCAGGGCTCCCGAGGCAGGCAGG - Intronic
1121342749 14:93115255-93115277 TCCGCGTCCCCGCCGCCGGGAGG - Exonic
1132585981 16:705910-705932 TCCGGGTTCGCGAGCCCGGGCGG + Intronic
1132759137 16:1500509-1500531 TCGGGGCGCCCGAGGCCGGGGGG - Intronic
1133053704 16:3134350-3134372 TCAGGGGTCCCACGGCCCGGAGG - Intronic
1133131055 16:3676352-3676374 TCCTGGTTCCCTCGGGCGGGGGG + Intronic
1133136657 16:3717191-3717213 TCAGGGCTCCCATGGGCGGGTGG + Intronic
1138553220 16:57758422-57758444 GGAGGGTTCCCGCAGCTGGGGGG - Exonic
1139684295 16:68590717-68590739 GCAGGCTTCCTGCGGCCGGGCGG - Intergenic
1139852941 16:69961765-69961787 CCAGGGTTCCTGCAGCAGGGTGG - Intronic
1139881912 16:70184673-70184695 CCAGGGTTCCTGCAGCAGGGTGG - Intronic
1140370599 16:74410833-74410855 CCAGGGTTCCTGCAGCAGGGTGG + Intronic
1140979276 16:80091339-80091361 TCAGTGTTCCCCCTGCTGGGGGG + Intergenic
1141214556 16:82011332-82011354 CCAGGGTCCCCGCGGAAGGGCGG + Intronic
1142118949 16:88376555-88376577 CTGGGGTTCCCGCGGCCGGCCGG + Intergenic
1147389291 17:40099470-40099492 ACAGGGCTCCGGCCGCCGGGAGG - Intronic
1149994308 17:61399060-61399082 TGAGCTTTCCAGCGGCCGGGAGG - Intergenic
1151780293 17:76240723-76240745 GCCGGGTGCCCGCGGCGGGGCGG + Intergenic
1152703886 17:81833139-81833161 GCAGGGCACCCGCGGCCGCGCGG + Intronic
1152904104 17:82961023-82961045 TCAGGCGTCCCGGGGCCGGGCGG + Intronic
1154332683 18:13442608-13442630 TCAGGCTCCCCGCAGCCGGCCGG - Intronic
1155500111 18:26479420-26479442 CCAGCGTTCCCACGGCCTGGCGG - Intronic
1158277102 18:55780410-55780432 GCCGGGTTCCCGCGGCCGCGAGG - Intergenic
1159393752 18:67830220-67830242 TGAGGTTTCCCGTGGCCCGGTGG - Intergenic
1160251877 18:77210240-77210262 TCAGGGTTGTTGCTGCCGGGTGG + Intergenic
1160723916 19:609200-609222 TCAGGGCAGCTGCGGCCGGGCGG + Intronic
1161159668 19:2754948-2754970 TCTGGGTTCCTGAGGCCTGGGGG - Exonic
1162315597 19:9936450-9936472 GCAGGGTCGCCCCGGCCGGGCGG - Exonic
1164179409 19:22806598-22806620 TGAAGCTTCCCGGGGCCGGGAGG - Intergenic
946622458 2:221573610-221573632 CCTGGGTCCCGGCGGCCGGGCGG + Intronic
948260631 2:236602007-236602029 TCATGGTTCCCACGCCCTGGTGG - Intergenic
948432264 2:237927362-237927384 TCAGGGTTTCAGCGGCCAGGAGG - Intergenic
1169216748 20:3798580-3798602 TCAGGATCCCCATGGCCGGGGGG + Intronic
1173594235 20:44248232-44248254 TCAGGGTTCCCGCTTCCTGGGGG + Intronic
1174400571 20:50273739-50273761 CCAGAGTGCCCGGGGCCGGGGGG - Intergenic
1176194499 20:63831059-63831081 TCATTGTCCGCGCGGCCGGGCGG - Intronic
1180042670 21:45288161-45288183 TGAGGGTCCGCGAGGCCGGGAGG + Intergenic
1180748847 22:18110870-18110892 TGAGGCTTCCCGGGGCCAGGCGG + Intronic
1180943350 22:19674987-19675009 TCAGGGTTCCCAGGACCGAGGGG - Intergenic
1181756951 22:25030868-25030890 TCCTGGTTCCCAGGGCCGGGAGG - Intronic
1183536118 22:38402398-38402420 TCAGGGGCCCCGGGGCCAGGGGG - Intergenic
1183647435 22:39134655-39134677 TCAGGGCTCCCGCTGCCGAGTGG + Exonic
953027424 3:39153200-39153222 TCGGGGTTACCGCGGCGGGCGGG + Intronic
953484979 3:43286602-43286624 GCGGGGTTTCGGCGGCCGGGAGG + Exonic
958942949 3:100334945-100334967 TCCGGGATCGCGTGGCCGGGCGG + Intronic
959530705 3:107431449-107431471 TCTGGGTTCCCGCGGCCTGTGGG + Intergenic
961712022 3:128835124-128835146 ACAGGGTACCCGAGGTCGGGTGG - Intergenic
966940193 3:184741243-184741265 TCAGGGTCCCCATGGCTGGGTGG - Intergenic
967272169 3:187740961-187740983 TCAGGGTACCGCCGCCCGGGAGG + Intronic
970637199 4:18022042-18022064 TCAGGGTTTTCGCGGGCGGCGGG - Intergenic
980451941 4:132984746-132984768 TCAGGGTTCGGGAGGCAGGGTGG - Intergenic
983940729 4:173531895-173531917 TCAGGTTTGCCGCGGCTGGGCGG + Intergenic
984622534 4:181970652-181970674 TCAGGGTTCCAGAGGCCATGTGG + Intergenic
985538687 5:478017-478039 TCAGGGTCCCCAGGGCCGGCAGG + Intronic
985539838 5:482789-482811 GCTGGGGTCCCGCGGCTGGGAGG - Intronic
986468865 5:8053498-8053520 CCAGGGTTCCCGCGGCTCAGCGG - Intergenic
986695846 5:10353846-10353868 ACGAGGCTCCCGCGGCCGGGCGG - Exonic
990825598 5:59894040-59894062 TCAGGGTTCCGGTGCCCTGGAGG - Intronic
1001016719 5:168148568-168148590 TCAGGGTTCCCTGGGCCACGTGG + Intronic
1006136099 6:31897298-31897320 CCGGGGTCCCCGCGGCCTGGGGG - Intronic
1006670660 6:35728005-35728027 GCATGGTTGCGGCGGCCGGGAGG + Intronic
1009170644 6:60395008-60395030 CCAGGGTTCCCTTGGCTGGGGGG - Intergenic
1012997919 6:105992335-105992357 TCAGGGTCCGCGCTCCCGGGAGG - Intergenic
1017412791 6:154186896-154186918 GCAGGGTTCCCTCTGCAGGGAGG - Intronic
1019455527 7:1124975-1124997 TCTGGCTTCCCTCGCCCGGGGGG + Intronic
1019483184 7:1275491-1275513 AGAGGGTCCCCGCAGCCGGGCGG - Intergenic
1019685886 7:2382027-2382049 TCAGGGTCCCCACGGCTGGCGGG + Intergenic
1038410144 8:27352079-27352101 TCAGGGGACCCACGGCGGGGGGG + Intronic
1047510684 8:125513154-125513176 TCCGTGTTCCCGTGGCCGCGTGG + Intergenic
1048490530 8:134888079-134888101 TCATGGTTGCCGGGGCCTGGAGG - Intergenic
1049361454 8:142214175-142214197 TCTGGGTTCCCAGGGCCAGGCGG - Intronic
1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG + Intronic
1053123374 9:35561702-35561724 ACAGGGTTCCCTAGGCCAGGTGG + Exonic
1057228885 9:93306889-93306911 TCAGGGTTCCCGCGGCCGGGCGG + Intronic
1059354485 9:113688122-113688144 CCAGGGTTCCCGCGGGTGAGGGG - Intergenic
1061416928 9:130452045-130452067 TCAGGGTTCCCGGGGGTGGCAGG + Intronic
1062574575 9:137200254-137200276 TCGGGGCTCCCGCGGCGGCGCGG + Exonic