ID: 1057230659

View in Genome Browser
Species Human (GRCh38)
Location 9:93319589-93319611
Sequence AAACCAAGCCTCCTGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 5, 3: 15, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057230659_1057230661 0 Left 1057230659 9:93319589-93319611 CCTGTCTCCAGGAGGCTTGGTTT 0: 1
1: 0
2: 5
3: 15
4: 164
Right 1057230661 9:93319612-93319634 GCATTACTTGCTGCAGCCCCTGG No data
1057230659_1057230669 25 Left 1057230659 9:93319589-93319611 CCTGTCTCCAGGAGGCTTGGTTT 0: 1
1: 0
2: 5
3: 15
4: 164
Right 1057230669 9:93319637-93319659 CCACCCTCTTTGCTCCAGATGGG No data
1057230659_1057230662 1 Left 1057230659 9:93319589-93319611 CCTGTCTCCAGGAGGCTTGGTTT 0: 1
1: 0
2: 5
3: 15
4: 164
Right 1057230662 9:93319613-93319635 CATTACTTGCTGCAGCCCCTGGG No data
1057230659_1057230667 24 Left 1057230659 9:93319589-93319611 CCTGTCTCCAGGAGGCTTGGTTT 0: 1
1: 0
2: 5
3: 15
4: 164
Right 1057230667 9:93319636-93319658 GCCACCCTCTTTGCTCCAGATGG No data
1057230659_1057230663 2 Left 1057230659 9:93319589-93319611 CCTGTCTCCAGGAGGCTTGGTTT 0: 1
1: 0
2: 5
3: 15
4: 164
Right 1057230663 9:93319614-93319636 ATTACTTGCTGCAGCCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057230659 Original CRISPR AAACCAAGCCTCCTGGAGAC AGG (reversed) Intronic
900193011 1:1359292-1359314 ATTACAAGCCTCCTGGAGAAAGG + Intronic
901027015 1:6284101-6284123 AAACCAGGGCCCCTGGAAACTGG - Intronic
903931665 1:26865552-26865574 AATCCAAGCCTCTCGGCGACAGG - Intergenic
905848757 1:41257595-41257617 AATCCAAGGCGACTGGAGACTGG - Intergenic
905902806 1:41592887-41592909 AGCCCAGGCCTCCTGGACACCGG + Intronic
906243991 1:44260420-44260442 AAGCCAAGCCTCCTGGGAAGGGG + Intronic
912883708 1:113446621-113446643 AAAGTGAGCCTCCTGTAGACAGG - Intronic
917062692 1:171057436-171057458 AAACAAAGCCTCCAGGAAACTGG + Intronic
922875062 1:228934046-228934068 AATCCCAGCCTACTGGAGAATGG + Intergenic
923775608 1:236975685-236975707 AAACCAATCTTCATGGAAACAGG - Intergenic
923789920 1:237103382-237103404 CAACCAATCCTCCTGTAGCCTGG + Intronic
1062840471 10:666507-666529 AAACCAAGCCTGCAGGACTCCGG + Intronic
1063381575 10:5589223-5589245 GAACCTGCCCTCCTGGAGACTGG - Intergenic
1064435415 10:15306906-15306928 AGACCAAGCCTCCTAGAGCACGG + Intronic
1067980948 10:51083635-51083657 AAACCAAGCCTCCTGGAAAGGGG - Intronic
1069552529 10:69374581-69374603 AAACCAAGGCTCATGGAGACCGG - Intronic
1070502263 10:77083072-77083094 AAACCAAGCCACCGGTAGAGGGG + Intronic
1070804744 10:79264460-79264482 AAAGCAAGCGTGCTGGAGAGGGG - Intronic
1073041795 10:100612822-100612844 AAACCTAGACTCTTGGAGAAAGG + Intergenic
1076702100 10:132278873-132278895 AAACCAACCCAACAGGAGACGGG + Intronic
1077872560 11:6274354-6274376 AAACAAAGCCTTCTGTAGACAGG + Intergenic
1078416348 11:11169345-11169367 AAGCCAAGGCTTCTGGAGCCTGG + Intergenic
1079145424 11:17847048-17847070 TGAGCAAGCCTCCTGGTGACAGG + Intronic
1080072658 11:28108400-28108422 TCACCAGGCCTCCTGTAGACCGG + Exonic
1080266752 11:30409157-30409179 AAAACAAGCCTCCCAGAGATAGG - Intronic
1081849526 11:46265418-46265440 AAACCAAGTCTCTTGAAGAGAGG - Intergenic
1083354516 11:62056214-62056236 TCAGCAAGCCTCCTGGAGGCAGG + Intergenic
1084329746 11:68423453-68423475 AAACCAAGACTCCTGAGCACTGG - Intronic
1085449163 11:76621759-76621781 AAACCAGGGCTCTAGGAGACAGG - Intergenic
1086096582 11:83055876-83055898 ACACCAAGCCTGCTGGCGCCTGG + Intronic
1088117315 11:106327290-106327312 AACCCAGGGCTACTGGAGACAGG - Intergenic
1090108695 11:123880911-123880933 AACCCAAGACTCCCGGATACAGG + Intergenic
1091345134 11:134847321-134847343 AAACGCAGCCTCCTGGGGAAGGG + Intergenic
1093484388 12:19637818-19637840 AAACCAAGTCTCCTGGTTCCTGG - Intronic
1095681103 12:44977174-44977196 GAACCAAGCCTTATGGACACAGG + Intergenic
1098362429 12:69667629-69667651 AAAGAAAGCCTCTTGGAGTCAGG - Intronic
1102576843 12:113861055-113861077 AAACCAAGGCTCTGGGAGCCAGG + Intronic
1102577792 12:113867443-113867465 AATCCACGCCCCCTGGAGGCCGG - Intronic
1102870374 12:116409427-116409449 ACAGAAAGCCTCCTGGAGACCGG - Intergenic
1102942059 12:116951888-116951910 AAAACAAGCCTCAGGGAGACAGG - Intronic
1104441430 12:128796678-128796700 AACCCCAGCTTCCTGGAGCCTGG + Intronic
1104532408 12:129584550-129584572 GAAGCAAGCCACCCGGAGACAGG + Intronic
1106949550 13:34867890-34867912 ACCCCAAGCTTCCTGGAGTCAGG + Intergenic
1112211927 13:97386512-97386534 ATACTAAGCCTCCTGGGGCCAGG - Intronic
1112426132 13:99303010-99303032 AAAGCAAGCCCCCAGGAGGCAGG - Intronic
1112829229 13:103428187-103428209 AAACCAACCCTCAAGGAGAGAGG + Intergenic
1113556447 13:111239463-111239485 AACCTGAGCCTCCTGGTGACAGG + Intronic
1118660191 14:68000711-68000733 AAAATAAGCCTCATGGAGAAGGG + Intronic
1118706760 14:68487195-68487217 AAACCAAACCTGCTGGAGCCTGG - Intronic
1119021593 14:71120686-71120708 ACAGCAAGCCTCATGGAAACTGG + Intergenic
1121757282 14:96413593-96413615 AAACCACGTCACCTGGAGCCAGG - Intronic
1122073623 14:99221634-99221656 AATCCAAGCCTCCTCGAGCCTGG - Intronic
1123056241 14:105572032-105572054 AACCCAGGGCTCCTGGAGAAGGG + Intergenic
1123057692 14:105579775-105579797 AACCCAGGGCTCCTGGAGAAGGG - Intergenic
1123080670 14:105692160-105692182 AACCCAGGGCTCCTGGAGAAGGG + Intergenic
1123081971 14:105699708-105699730 AACCCAGGGCTCCTGGAGAAGGG - Intergenic
1126382909 15:48066839-48066861 CAACCAGGCCTCCTGGGCACAGG - Intergenic
1126572849 15:50170003-50170025 AAACAAAGCCTCCAAGAGTCTGG + Intronic
1127867736 15:63045334-63045356 AAATCAAGCTTCCTGGAAAGGGG + Intronic
1131716674 15:95119071-95119093 AACCCAAGTCTGTTGGAGACAGG - Intergenic
1134101038 16:11451748-11451770 AACCCACCCCTGCTGGAGACAGG + Intronic
1134387769 16:13789917-13789939 AAACCAGGCATCCTGGATCCAGG - Intergenic
1134785446 16:16938183-16938205 AGATCAAGGCTCCTGGAGAGAGG - Intergenic
1139494831 16:67308754-67308776 ATACCAAGCTTCCTGGGGAGAGG + Intronic
1142599727 17:1047770-1047792 ACTGCAAGCCTCTTGGAGACAGG - Intronic
1143086625 17:4420961-4420983 AACCCAGGCCTCCTGGAGCTAGG - Intergenic
1145103891 17:20098833-20098855 AAAGTAAGCCCCCTGCAGACAGG + Intronic
1147033994 17:37666277-37666299 TAACTAAACCTCCTAGAGACAGG - Intergenic
1149137333 17:53383501-53383523 AAACAAAGCCTCCTTTATACAGG + Intergenic
1152150249 17:78595159-78595181 AGACGAAGCCTCCAGGAGGCAGG - Intergenic
1153564689 18:6407919-6407941 GCTCCAAGCCTCCTTGAGACTGG - Intronic
1156391225 18:36652392-36652414 AAACCAAAGCTGCTGGTGACAGG + Intronic
1157088904 18:44612254-44612276 AAATCAAGCCTCCAGGACAGTGG - Intergenic
1157482780 18:48066192-48066214 AAACCAAGGCTGGTGGAGCCAGG - Intronic
1158408255 18:57179510-57179532 AACCCAAGCCTGAAGGAGACAGG + Intergenic
1158647889 18:59264143-59264165 AATCCAAGCCTCCAGGAGGTGGG - Intergenic
1158859898 18:61581977-61581999 AAACCCAGCCTCCCGGTGCCCGG + Intergenic
1162038019 19:7953000-7953022 AAGTCAAGCCTCATGGAGACAGG - Intergenic
1163375595 19:16928245-16928267 AAACCAAGGCTGCTGGACGCTGG + Intronic
1167277979 19:48550345-48550367 CAGCTCAGCCTCCTGGAGACGGG + Intergenic
1168359212 19:55724423-55724445 AAACCGAGCCCCATGGGGACAGG + Intronic
925753496 2:7110736-7110758 AGAAAAGGCCTCCTGGAGACAGG - Intergenic
928626962 2:33149563-33149585 AAATCAAGCCTCTAGGAGCCTGG - Intronic
928829867 2:35467836-35467858 AAACTCAGTCACCTGGAGACAGG - Intergenic
928936108 2:36679893-36679915 AAACCAAGCCTTTAAGAGACAGG - Intergenic
929620682 2:43350993-43351015 ACACAAAGCCTGCTGGGGACTGG + Intronic
930452107 2:51554979-51555001 AAACCAAGCCATCTGAAGCCTGG - Intergenic
932792048 2:74662314-74662336 AAAGCAGGCCTCCTGAGGACTGG - Intronic
936376046 2:111942299-111942321 AAACCAAGGCTACTGAAGAGGGG - Intronic
936508638 2:113128135-113128157 AAACCAAGGTCCCTGGAGAGTGG - Intronic
936663252 2:114565692-114565714 AAGACAAGCCTCCTGGGGATAGG - Intronic
939957975 2:148542516-148542538 AAACAAAGTCTGCAGGAGACTGG + Intergenic
943341129 2:186683487-186683509 TAGCCAAGCCTCCTGGATCCTGG - Intergenic
946478821 2:220034166-220034188 AAACAAAGCCTCCGGGGGACGGG + Intergenic
947525979 2:230877019-230877041 AGACCTAGCCTCCATGAGACAGG - Intronic
947742091 2:232489305-232489327 AAAATTATCCTCCTGGAGACGGG - Intergenic
947746645 2:232511439-232511461 GGACCACGCCTCCTGGGGACTGG - Intergenic
948022389 2:234745631-234745653 AGACCCATCCTCCTGGAGCCTGG - Intergenic
948072298 2:235137783-235137805 AAAACAGGCCTCCTTGAGGCAGG - Intergenic
948669514 2:239558959-239558981 AAGCCAAGCCTCTTGGGCACAGG - Intergenic
1169385807 20:5148477-5148499 AAACTGAGGCTCATGGAGACTGG + Intronic
1170495748 20:16923501-16923523 GAAGCAAGAGTCCTGGAGACAGG - Intergenic
1170982469 20:21227358-21227380 AAACAAAGCCTCCTGGCCACTGG - Intronic
1172264842 20:33602062-33602084 AATCCAAACCACCTTGAGACGGG - Intronic
1172606455 20:36217417-36217439 GAACCACTCCTCCTGGAGGCAGG + Intronic
1173448131 20:43138442-43138464 AAACTGAGGCTCATGGAGACAGG - Intronic
1174645144 20:52079285-52079307 AAATCAAGACTCCTGGATAGGGG - Intronic
1174933663 20:54843900-54843922 TAAGCAAGCCTCATGGAAACGGG - Intergenic
1175503822 20:59468333-59468355 AAATCAGGCCTCCTGGAGGCAGG + Intergenic
1181993829 22:26859216-26859238 CATTCAAGCCTCCTGGAGACAGG - Intergenic
1182418833 22:30238757-30238779 TGAGCCAGCCTCCTGGAGACTGG + Intergenic
1182450731 22:30419154-30419176 AAACCAGGCCTCCTGGTGCCTGG - Intronic
1184043655 22:41958755-41958777 AAACCCAGCCCCCTTGAGCCAGG + Intergenic
1184408953 22:44315709-44315731 AAACCAAGCCTCCTCGAGGCAGG - Intergenic
1184747987 22:46466969-46466991 AAACAAAGCCTCCAGGAACCTGG + Intronic
1185133558 22:49055580-49055602 AACCCCAGCTTCCAGGAGACAGG - Intergenic
1185178649 22:49346750-49346772 GGACCAAGTCTCCAGGAGACGGG - Intergenic
1185306221 22:50118525-50118547 AAACCAACCCCCAAGGAGACAGG + Intronic
949617494 3:5770140-5770162 AACACAAGCCACCTGCAGACAGG - Intergenic
950529754 3:13546359-13546381 AAACCAAGCTTCGGGGAGAAAGG - Intergenic
951603826 3:24409262-24409284 AAACCAAGACTCCTATAGAGTGG - Intronic
952971876 3:38656490-38656512 CAGCCAAGCCTCCTGGAAGCTGG + Intergenic
953777797 3:45837773-45837795 ACACTAAGCCTCATGGATACAGG - Intronic
954069303 3:48131177-48131199 AAACTAAGGCTCCAGGAGACTGG - Intergenic
955716620 3:61836456-61836478 AAAGCTGGCCTCCAGGAGACAGG - Intronic
955853112 3:63242369-63242391 AAACCAGGACTCCTAGGGACTGG + Intronic
957658485 3:83114552-83114574 AAAAGAATCCTCCTGGAGAATGG + Intergenic
964643016 3:158929896-158929918 AAACCAAGCCTACTGGGCGCGGG + Intergenic
969928672 4:10609603-10609625 GATCCAAGACTCCTGGAGGCAGG + Intronic
970272714 4:14364528-14364550 TAACCAGGCATCCTGGAGGCTGG - Intergenic
975577361 4:75876375-75876397 CAAGCAGGCCTCCTGGTGACCGG - Exonic
981938245 4:150256241-150256263 AGACTGAGCCTCCTGCAGACGGG + Exonic
982305888 4:153930131-153930153 AAACCAAGCCACATGGACTCAGG + Intergenic
982641815 4:157971095-157971117 AAAAAAAGCTTCCTAGAGACAGG - Intergenic
983676601 4:170301839-170301861 AAATCCAGCCTCCTCCAGACAGG - Intergenic
984156231 4:176198750-176198772 CAACCAACCATACTGGAGACTGG - Intergenic
984267028 4:177507676-177507698 AAATCAAGCCTCATGGAGACTGG + Intergenic
986401776 5:7389039-7389061 AGTCCAAGCCTCCTGGAGCCAGG + Intergenic
987218722 5:15767410-15767432 AGACTATGCCTCCTGCAGACAGG - Intronic
989213990 5:38884850-38884872 GAACCAGGCATCCAGGAGACTGG - Intronic
991170895 5:63624497-63624519 AAATCAAGCCTACTAGAGAAGGG - Intergenic
992617512 5:78559009-78559031 AAACATAGCCTCATGGAGGCAGG - Intronic
993300424 5:86202588-86202610 AATCCAAGCATCCTTGAGAGGGG + Intergenic
997294279 5:132760141-132760163 AACACTGGCCTCCTGGAGACTGG - Intronic
998214345 5:140226024-140226046 AAAGCAGGCCTCTTGTAGACAGG - Intronic
1001525895 5:172428642-172428664 AAACCTAGCCTCATGGATAGAGG + Intronic
1002643628 5:180642268-180642290 AAACCAAGCATTCAGGAGGCAGG - Intronic
1004518287 6:16339217-16339239 AAACCCAGCCCCCTGGTGGCTGG - Intronic
1005509532 6:26500212-26500234 ATACCAGGCCACCTGGAGGCAGG + Intergenic
1006947028 6:37791457-37791479 AAACCCCGCCTTCTGGAGGCGGG - Intergenic
1008295179 6:49766851-49766873 AAAGCAACCCTCCTGGAGCGTGG - Intergenic
1013328185 6:109069281-109069303 AAAACAAGCCTCCTAGAGAGGGG + Intronic
1013533081 6:111038246-111038268 AAAGCGAGCCTTCTGGGGACTGG - Intergenic
1015799678 6:137047347-137047369 AAGCGAAGCCTCCAGGAAACTGG - Intergenic
1018968160 6:168504781-168504803 AATCCCATCCTCCTGGAGGCTGG + Intronic
1020961776 7:14814114-14814136 AATCCAAGCCAACTAGAGACTGG + Intronic
1022122622 7:27324100-27324122 TAGCCAGGCCTCCTAGAGACTGG + Intergenic
1024008955 7:45251829-45251851 AACTCAGACCTCCTGGAGACTGG - Intergenic
1026892754 7:73992091-73992113 TGACCAAGCCCCCTGGAGAGGGG + Intergenic
1029312349 7:99679074-99679096 AATCCTAGCCTCCCAGAGACGGG + Intronic
1032780401 7:135161222-135161244 AAACAAAGGCTCCTGGCGTCTGG + Intronic
1034210488 7:149358543-149358565 CTTCCAAGCCTACTGGAGACAGG + Intergenic
1035228109 7:157444632-157444654 AGACACAGCCTCCTGGGGACGGG - Intergenic
1037016098 8:13908610-13908632 AAACCAATCTTCATGAAGACCGG - Intergenic
1037018977 8:13944559-13944581 TAGCCAAGCCTCTTGGAGAATGG + Intergenic
1039788540 8:40855526-40855548 AAACCAGGTCTCATGGAAACTGG + Intronic
1043064161 8:75545199-75545221 AAACCATACCTTCTGGAGTCAGG + Intronic
1043082992 8:75789395-75789417 AAAACATGTCTCATGGAGACAGG + Intergenic
1045796796 8:106055846-106055868 AAAGGAAGGCTGCTGGAGACTGG - Intergenic
1046162052 8:110378514-110378536 GAATCAAACCTCCTTGAGACTGG - Intergenic
1048067632 8:130986588-130986610 AAAGCAAGCCTCCTGGAGAAAGG + Intronic
1049286999 8:141781184-141781206 CAACCACGACTCCTGGAGCCTGG - Intergenic
1052145578 9:25044638-25044660 AAACAAAGCCTCCAAGAAACAGG - Intergenic
1055085060 9:72305344-72305366 AATCCCATCCTCCTGGAGCCAGG - Intergenic
1055927652 9:81527128-81527150 GAAACAGGCCTCCTGGAGAGTGG - Intergenic
1056709157 9:88976789-88976811 GATCCAAGCCTTCTGGAGAGTGG + Intergenic
1057230659 9:93319589-93319611 AAACCAAGCCTCCTGGAGACAGG - Intronic
1060023789 9:120154171-120154193 AAACTGAGCCTCCTAGACACTGG + Intergenic
1060787639 9:126463230-126463252 AACTCACGCCTCTTGGAGACGGG - Intronic
1060990373 9:127845509-127845531 AAAGCAAGCTCCCTGGAGCCAGG + Intronic
1061949025 9:133925772-133925794 AAACCAGTACTCCTGGAGAAAGG + Intronic
1062406394 9:136398755-136398777 ACACCAAGCCACATGGAAACTGG + Exonic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1189233864 X:39472911-39472933 AGAGCCAGCCTCCGGGAGACTGG + Intergenic
1192013017 X:67295647-67295669 AAACCTAGCCTCCTGCTGATAGG + Intergenic