ID: 1057230738

View in Genome Browser
Species Human (GRCh38)
Location 9:93319938-93319960
Sequence GTGGACCGGGCAGGAGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057230738_1057230748 0 Left 1057230738 9:93319938-93319960 CCAGTGTCTCCTGCCCGGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 263
Right 1057230748 9:93319961-93319983 TGTGGGGGCTGCCTTGGCTGTGG No data
1057230738_1057230750 2 Left 1057230738 9:93319938-93319960 CCAGTGTCTCCTGCCCGGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 263
Right 1057230750 9:93319963-93319985 TGGGGGCTGCCTTGGCTGTGGGG No data
1057230738_1057230749 1 Left 1057230738 9:93319938-93319960 CCAGTGTCTCCTGCCCGGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 263
Right 1057230749 9:93319962-93319984 GTGGGGGCTGCCTTGGCTGTGGG No data
1057230738_1057230746 -6 Left 1057230738 9:93319938-93319960 CCAGTGTCTCCTGCCCGGTCCAC 0: 1
1: 0
2: 1
3: 18
4: 263
Right 1057230746 9:93319955-93319977 GTCCACTGTGGGGGCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057230738 Original CRISPR GTGGACCGGGCAGGAGACAC TGG (reversed) Intronic
900190233 1:1349995-1350017 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190249 1:1350035-1350057 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190265 1:1350075-1350097 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190281 1:1350115-1350137 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190297 1:1350155-1350177 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190313 1:1350195-1350217 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190329 1:1350235-1350257 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190345 1:1350275-1350297 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190361 1:1350315-1350337 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190392 1:1350395-1350417 CTGGACCGGGCAGGAGCGACGGG + Intergenic
900190408 1:1350435-1350457 CTGGACCGGGCAGGAGCGACGGG + Intergenic
900190425 1:1350475-1350497 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190441 1:1350515-1350537 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190457 1:1350555-1350577 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190473 1:1350595-1350617 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190489 1:1350635-1350657 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190505 1:1350675-1350697 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190521 1:1350715-1350737 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190537 1:1350755-1350777 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190552 1:1350795-1350817 CTGGACCGGGCAGGAGCGACGGG + Intergenic
900190569 1:1350835-1350857 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190585 1:1350875-1350897 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190601 1:1350915-1350937 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190617 1:1350955-1350977 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190632 1:1350995-1351017 CTGGACCGGGCAGGAGCGACGGG + Intergenic
900190648 1:1351035-1351057 CTGGACCGGGCAGGAGCGACGGG + Intergenic
900190665 1:1351075-1351097 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190681 1:1351115-1351137 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190713 1:1351195-1351217 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190729 1:1351235-1351257 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190744 1:1351275-1351297 CTGGACCGGGCAGGAGCGACGGG + Intergenic
900190761 1:1351315-1351337 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190777 1:1351355-1351377 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900190793 1:1351395-1351417 CTGGACGGGGCAGGAGCGACGGG + Intergenic
900371608 1:2334596-2334618 GTGGAGCCGGCAGGAGGCAGGGG + Intronic
900844031 1:5081827-5081849 GTGGAACGTGGAGGAGTCACAGG - Intergenic
901821744 1:11834765-11834787 GGGGGCAGGGCAGGGGACACGGG + Intronic
902392752 1:16115829-16115851 GTGGCGCGGGCAGGAGGCAGGGG + Intergenic
902874130 1:19330855-19330877 GGGGACAGGGCAGGGGAGACTGG - Intergenic
903176698 1:21585826-21585848 ATAGACCAGGCAGGAGAAACTGG + Intergenic
903314712 1:22493626-22493648 GTGGAAGGGGCAGGAGAGAGGGG - Intronic
903340923 1:22653765-22653787 CTGGGCCGGGCAGGAGCGACTGG - Intronic
904746335 1:32713463-32713485 GTGGACCTGGGAGAGGACACGGG - Intergenic
905992367 1:42349402-42349424 GTGGACAGGGCCGGACACAGTGG - Intergenic
906245132 1:44267990-44268012 GTGGCACAGGCAGGAGGCACAGG + Intronic
912704957 1:111904817-111904839 GTGGAGCGGGGAGGGGACAGGGG + Intronic
913070954 1:115298124-115298146 GTGGGTCAGGCAGGAGAGACAGG - Intronic
914341229 1:146762226-146762248 TTGGGCAGGGCAGGAGACCCAGG - Intergenic
914490474 1:148147837-148147859 GTGGCCCAGGCAGTAGAGACAGG - Intronic
914666969 1:149840411-149840433 GGGGCCGGGGCAGGAGAGACGGG - Exonic
914668798 1:149853379-149853401 GGGGCCGGGGCAGGAGAGACGGG + Exonic
915269274 1:154742163-154742185 GAGGACAGGGCAGGAGTGACAGG - Intronic
915562119 1:156693432-156693454 GGGGACAGGGGAGGTGACACAGG - Intergenic
915597905 1:156905836-156905858 GTGCAGTGGGCAGGAGAGACTGG - Intronic
915923071 1:159992594-159992616 GGGGAGCAGGGAGGAGACACAGG - Intergenic
919640193 1:200039079-200039101 GTGGACCAGGCAGGAGAGGGAGG + Intronic
921023615 1:211258948-211258970 GCGGACCGGGCTGCAGGCACGGG - Intronic
921390056 1:214607380-214607402 GTGGCCCAGGCAGTAGAGACAGG + Intronic
922507086 1:226132896-226132918 GTGGAACTGGAAGGAGACCCGGG - Intergenic
1063431358 10:5991697-5991719 GTGGCCTGGGCATGTGACACAGG - Intergenic
1063661832 10:8039737-8039759 GTGGAAGGGGCAGGAGTCATTGG - Intergenic
1063962458 10:11318368-11318390 GGGGACCAGTCAGGGGACACGGG - Intronic
1070831840 10:79422505-79422527 GGGGAAAGGGCAGGAGACAAGGG - Intronic
1072747399 10:97950548-97950570 TTGGACAGGCAAGGAGACACAGG + Intronic
1072847281 10:98845754-98845776 GTGCACTGGTCAGGACACACTGG - Intronic
1073042899 10:100619375-100619397 GAGGACCAGGAAGGAGACAGAGG - Intergenic
1073942024 10:108710471-108710493 GTGGACTGTGCAGGAAACACAGG - Intergenic
1076855564 10:133114042-133114064 CAGGACCGGGCAGGAGACGGAGG - Intronic
1077407099 11:2387558-2387580 GTGGACAGTGCAGGAGAGGCAGG - Intronic
1078329688 11:10409290-10409312 GAGGACAGGGCAGGAGGGACTGG - Intronic
1078361858 11:10675319-10675341 GGGAACCGGGCAGGAGCCAACGG - Intronic
1078545158 11:12241853-12241875 CTGGACTGGGCATGAGACATTGG - Intronic
1079244812 11:18744223-18744245 GTGGACAGGGCCGGAGTCATCGG - Intronic
1083577731 11:63804456-63804478 GTGGACAGAGGAGGAGAAACAGG + Intergenic
1084006790 11:66327229-66327251 GAGGACCCTGGAGGAGACACTGG - Intergenic
1084758449 11:71253047-71253069 GTGGCCTGGGCAGCAGACGCCGG - Intergenic
1084901330 11:72312037-72312059 GTGGAGAGGGCAGGAGTTACAGG + Intronic
1084941076 11:72613662-72613684 GAGGAGTGGGCTGGAGACACAGG - Intronic
1085618961 11:78023067-78023089 GAGGGACGGGCAGGAGAAACTGG + Intronic
1086719403 11:90101487-90101509 GTGGTCCGGGCAGGAAATTCAGG - Intergenic
1088731476 11:112687663-112687685 GTGGACAGGGCAGGAGGGGCGGG + Intergenic
1089257245 11:117200423-117200445 GGGGTCCTGGCAGGAGCCACAGG + Intronic
1091883183 12:3996445-3996467 GTGGACCCTGTAGGAGACAGAGG - Intergenic
1093068899 12:14687800-14687822 GAGTACCAGGCAGGAGACTCTGG - Intronic
1096718914 12:53506959-53506981 GTGGAAAGGGCAGGAGGCAGAGG - Intronic
1097824189 12:64157860-64157882 GTGGATCGGGCAGGTGACTCAGG + Exonic
1103536583 12:121637704-121637726 GGGGAGGTGGCAGGAGACACTGG + Intronic
1108707781 13:53005780-53005802 GTGGAGCGGACAGGAGCCCCAGG - Intergenic
1109001652 13:56812414-56812436 GCTGACCTGGCAGGAGTCACTGG + Intergenic
1113389041 13:109878137-109878159 GTGCCTCGGGCAGGAGACTCCGG - Intergenic
1114736968 14:25051571-25051593 ATGGACAGGGCAGCAGACCCAGG + Intergenic
1116498734 14:45594323-45594345 GAGGAAAGGGCAGTAGACACAGG + Intergenic
1117996438 14:61482574-61482596 TTGAAGCAGGCAGGAGACACAGG - Intronic
1118907301 14:70032142-70032164 GTGGGCCTTGCACGAGACACTGG + Intronic
1119770341 14:77216790-77216812 AGGGTCCGGGCAGGAGACAATGG - Intronic
1119869977 14:78008677-78008699 GTGTCTAGGGCAGGAGACACAGG - Intergenic
1121320048 14:92986965-92986987 GTGGACAGGGCAGCAGCCCCTGG - Intronic
1121506636 14:94482689-94482711 CAGGAGCGGGCAGGAGAAACAGG - Intergenic
1122317041 14:100832059-100832081 GAGGAGCGTGCAGGAGAGACAGG + Intergenic
1122429462 14:101630603-101630625 GGGGCCCGGGCAGGAGGCAGGGG - Intergenic
1126246179 15:46508789-46508811 ATGGACCTGGGAGGAGAGACAGG - Intergenic
1127480438 15:59372438-59372460 GGGGACGGGGCAGGAAACCCCGG - Intronic
1129246708 15:74283328-74283350 GTGGAAGGGGCAGGAGACAGAGG - Intronic
1129804032 15:78438886-78438908 GTGGACGGGGGAGGAGACAGCGG - Intronic
1132308999 15:100842552-100842574 GTGAACAGAGCAGGAGACAGAGG + Intergenic
1132543335 16:521585-521607 GGGGGCCGGGCAGGAGCCTCTGG + Exonic
1132568254 16:632957-632979 CTGTACAGGGCAGGAGGCACGGG - Exonic
1133303393 16:4796233-4796255 TGCCACCGGGCAGGAGACACAGG - Exonic
1133737816 16:8629265-8629287 GTGAGCCGGGCAGGAGTGACGGG - Intronic
1133928620 16:10213931-10213953 GTGGACAGAGCAGGAGAGGCAGG - Intergenic
1136516492 16:30771801-30771823 GTGGAACAGGAAGGAGGCACTGG - Intronic
1136707299 16:32201006-32201028 GTGCCCCGGGCAGTAGAGACAGG - Intergenic
1136760612 16:32728411-32728433 GTGCCCCGGGCAGTAGAGACAGG + Intergenic
1136807491 16:33141975-33141997 GTGCCCCGGGCAGTAGAGACAGG - Intergenic
1136871605 16:33812471-33812493 GGGGGTGGGGCAGGAGACACAGG - Intergenic
1137033187 16:35543953-35543975 GTGGACAGGGCAGGAGGGAGTGG - Intergenic
1137268363 16:46886206-46886228 GTGGGCCGGGCAGAGAACACAGG + Intronic
1137688067 16:50400712-50400734 GTGGACAGAGAAAGAGACACAGG + Intergenic
1139290948 16:65857395-65857417 GTGCTCCTGGCAGGAGGCACAGG - Intergenic
1139993055 16:70955182-70955204 TTGGGCAGGGCAGGAGACCCAGG + Intronic
1141552278 16:84813974-84813996 GAGGAGAGGGCAGGAGACAATGG + Intergenic
1141647750 16:85376561-85376583 GTGGTCCTGGCTGGAGACACAGG + Intergenic
1142304685 16:89278692-89278714 GGGGCAGGGGCAGGAGACACAGG + Intronic
1203062764 16_KI270728v1_random:988726-988748 GTGCCCCGGGCAGTAGAGACAGG + Intergenic
1203100567 16_KI270728v1_random:1303587-1303609 GGGGGTGGGGCAGGAGACACAGG + Intergenic
1142497005 17:311228-311250 GTGGACCGAGGAGGAGGGACGGG - Intronic
1143281949 17:5761365-5761387 GGGGACAGGGGAGGTGACACAGG + Intergenic
1143320299 17:6064232-6064254 GTGCACCAGCCAGTAGACACAGG - Intronic
1144257112 17:13479954-13479976 ATGGACAGGGCAGGAGAAAGAGG - Intergenic
1145069239 17:19788856-19788878 GTGGAAGGGGCAGGAAAGACCGG + Intronic
1145191065 17:20842439-20842461 GTGGCCCAGGCAGTAGAGACAGG - Intronic
1146283612 17:31560087-31560109 GAGGACCGGGGAGAAGACGCTGG - Intergenic
1147054225 17:37821983-37822005 GGGGACTGGGGAGGAGAAACAGG - Intergenic
1150791154 17:68200988-68201010 GCGGACAGGGCAGGAGACCACGG + Intergenic
1151632221 17:75318755-75318777 CTGGACAGGTCAGGGGACACAGG + Exonic
1152073371 17:78144981-78145003 ATTGACCGGTCAGGAGCCACAGG + Intergenic
1152579831 17:81160920-81160942 GTGGACCGAGGAGGAGGCAGAGG + Intronic
1156539429 18:37894865-37894887 GTGGATGGGACAGGAGAGACAGG - Intergenic
1157251218 18:46098014-46098036 CTGGACAGAGCAGGCGACACAGG - Intronic
1157474873 18:48017041-48017063 GTGGTCCTGAGAGGAGACACTGG + Intergenic
1157523443 18:48361107-48361129 GTAGCCTGGGCAGGAGACCCAGG + Intronic
1158395901 18:57078185-57078207 GTGGGCTGGGCAGGGGAGACTGG + Intergenic
1160517376 18:79486115-79486137 GAGAACCAGGCAGGAGACAGAGG + Intronic
1160907158 19:1456760-1456782 GGGGACGGGGCAGGGGTCACAGG + Intronic
1160995136 19:1878984-1879006 GTGGCCCAGGCAGTAGAGACAGG + Intronic
1162903530 19:13809420-13809442 GTGGATCTGACAGGAGGCACAGG + Intronic
1163090471 19:15016119-15016141 GTGGACGAGGTAGGAGACTCAGG + Intronic
1165465476 19:35972242-35972264 GTAGTCCCGGCAGGAGACAATGG + Intergenic
1168096523 19:54118667-54118689 GGGGGCCTGGCAGGAGAGACAGG - Intronic
1168684805 19:58342135-58342157 GTAGACTGGGCAGCACACACAGG - Exonic
925171672 2:1754062-1754084 GTGGCCTGGGCTGGAGACCCTGG - Intergenic
925776399 2:7340115-7340137 GTGGGCTGGGGAGGAGGCACTGG + Intergenic
927588210 2:24329552-24329574 ATGGAACGGGCAGGACACAGTGG - Intronic
932417482 2:71582320-71582342 GTGGACAGGGCAGAAGGCAATGG - Intronic
934300959 2:91775812-91775834 GGGAAGCGGGAAGGAGACACAGG + Intergenic
935765408 2:106362236-106362258 GGGGACATGGCATGAGACACAGG - Intergenic
940602670 2:155880894-155880916 GTGTCCCCGTCAGGAGACACGGG - Intergenic
941581487 2:167301853-167301875 TTGGACTGGGCAGGAGACTATGG - Intergenic
948297664 2:236875020-236875042 AAGGACAGGGCAGGAGACATGGG - Intergenic
948607183 2:239143622-239143644 GGGGACAGGGCACGAGAAACAGG + Intronic
1169222907 20:3836950-3836972 GTGGAATGGGCAAGAGACTCAGG - Intergenic
1169345235 20:4823643-4823665 GAGGAGGGGGCAGGAGACAAGGG - Exonic
1171905911 20:30899621-30899643 GTGGGGCGGGCGGGAAACACTGG - Intergenic
1172589914 20:36110435-36110457 GGGGACTGGGCAGGAGAGAAGGG - Intronic
1173729335 20:45317656-45317678 GTGGACCAGGGAGCAAACACAGG - Exonic
1179035141 21:37753028-37753050 GTGGGCTGGGCAGGGAACACAGG + Intronic
1179778664 21:43685304-43685326 GTGCATGGGGGAGGAGACACTGG - Intronic
1179909165 21:44438848-44438870 GTGGCCCGAGCAGGGGGCACTGG - Intronic
1180816196 22:18791332-18791354 GGGAAGCGGGAAGGAGACACAGG - Intergenic
1180835524 22:18927671-18927693 GTGGGCCTGGCAGGAGAGGCTGG + Intronic
1180897347 22:19346500-19346522 GAGGACCTGGCAGAAGACACTGG + Intronic
1181334161 22:22116547-22116569 GTGGCCCAGGCAGTAGAGACAGG + Intergenic
1181699321 22:24610950-24610972 GGGAAGCGGGAAGGAGACACAGG + Intronic
1181859702 22:25808713-25808735 CTGGACCATGCAGGAGAAACAGG - Intronic
1181989061 22:26822763-26822785 GAACACCGGGCAGGAGACACAGG + Intergenic
1183409513 22:37646758-37646780 GTGGGCAGGGCAGGACACCCTGG - Intronic
1183456006 22:37923772-37923794 GTGGATGGGCCAGGACACACAGG - Intronic
1183568211 22:38631954-38631976 GTGGGAAGGGGAGGAGACACAGG + Intronic
1183668502 22:39258336-39258358 TGGGGCGGGGCAGGAGACACTGG + Intergenic
1184699759 22:46162705-46162727 GGGTACCCGGCAGGAGCCACAGG - Intronic
1203224528 22_KI270731v1_random:69749-69771 GGGAAGCGGGAAGGAGACACAGG + Intergenic
1203266299 22_KI270734v1_random:17043-17065 GGGAAGCGGGAAGGAGACACAGG - Intergenic
1203285612 22_KI270734v1_random:152970-152992 GTGGGCCTGGCAGGAGAGGCTGG + Intergenic
950282275 3:11719092-11719114 GGGGACCGGGCAGGAAGCACAGG + Intronic
952018154 3:28984465-28984487 GTGGCCAGGGCAGCAGAGACAGG - Intergenic
953128164 3:40111606-40111628 GTGGACAGTGCAGGAGTCCCAGG + Intronic
962073767 3:132058701-132058723 GGGGACAGGGCAGTAGACCCAGG - Intronic
962350297 3:134651276-134651298 GTGCACCGGGCGGGAGGCAGGGG - Intronic
962973867 3:140429370-140429392 TTGGACCAGGCAGGAGCCCCAGG + Intronic
963898735 3:150712831-150712853 GTCTACCAGTCAGGAGACACAGG - Intergenic
966856339 3:184196473-184196495 GTGGTCTGGCCAGGAGAAACAGG - Intronic
968008771 3:195259896-195259918 GAGGACCAGGCAGGAGCGACGGG + Intronic
968048214 3:195635580-195635602 AGGGACCGGGCAGGAGGCAGGGG - Intergenic
968099190 3:195954040-195954062 AGGGACCGGGCAGGAGGCAGGGG + Intergenic
968306397 3:197654341-197654363 AGGGACCGGGCAGGAGGCAGGGG + Intergenic
968377718 4:57439-57461 GTGATCCAGGCAGGAGACTCAGG - Intronic
968427736 4:534608-534630 GTGGACCAGGCAGGAGAGCATGG - Intronic
968479058 4:825912-825934 GGGGGCCGGGAAGGAGAAACCGG + Intronic
968479078 4:825961-825983 GGGGGCCGGGGAGGAGACGCCGG + Intronic
968666108 4:1823209-1823231 GGTGACGGGGCAGGGGACACAGG - Intronic
968873284 4:3252277-3252299 GAGGTCAAGGCAGGAGACACAGG - Intronic
969188424 4:5497449-5497471 GTGGACTGGGCAGGAACCAGAGG - Intronic
970371903 4:15416513-15416535 CTGGACCAGGCAGGATACAGGGG + Intronic
973257963 4:48131889-48131911 GTGGAGGTGGCAGGGGACACAGG + Intronic
978385361 4:108172002-108172024 CGGGAGCGGGCAGGAGAGACAGG + Intergenic
985504706 5:272073-272095 AGGGACCGGGCAGGAGGCAGGGG - Intronic
985632457 5:1021288-1021310 GGGGACCGGGCAGGGGAGCCGGG - Intronic
985743407 5:1633522-1633544 AGGGACCGGGCAGGAGGCAGGGG + Intergenic
994422087 5:99534624-99534646 CTGGATCAGGCAGGAGACCCTGG + Intergenic
994460757 5:100065960-100065982 CTGGATCAGGCAGGAGACCCTGG - Intergenic
994484905 5:100379386-100379408 CTGGATCAGGCAGGAGACCCTGG - Intergenic
997892082 5:137686256-137686278 TGGGTCCAGGCAGGAGACACAGG - Intronic
999077946 5:148815019-148815041 GTGGAGCATCCAGGAGACACAGG - Intergenic
999250787 5:150181096-150181118 GGGGACGGGACAGGAGACAAGGG - Intronic
999428933 5:151509802-151509824 ACGGACCAGGCAGGAGAAACGGG - Intronic
1001692494 5:173643472-173643494 GTGGAGCGGGGAGGAGAGAAGGG + Intergenic
1001713888 5:173798989-173799011 GTGTGCCAGGCAGGGGACACAGG - Intergenic
1005812654 6:29529105-29529127 GGGGTCAGGGCAGGGGACACAGG - Intergenic
1006837334 6:37006943-37006965 GTGGACTGGACAAGAGACTCTGG + Intronic
1007400730 6:41600826-41600848 GTGGAAGGGACAGGAGGCACAGG - Exonic
1007401657 6:41606028-41606050 GTGGACTGGGCAGGACACCTGGG + Intergenic
1008143483 6:47859941-47859963 GTGGTCAGAGCAGGAGACAGGGG + Intergenic
1010477451 6:76305721-76305743 TTGGACAGAGCAGGTGACACAGG - Intergenic
1010959567 6:82130283-82130305 GTGTACCAGGCAGGGGACAGAGG + Intergenic
1016428432 6:143958120-143958142 GTGCACCTGGCAGGGGACACTGG + Intronic
1017432589 6:154385583-154385605 GAGGGACGGGGAGGAGACACTGG - Intronic
1018101420 6:160444466-160444488 GTGGAGGGAGCAGGTGACACAGG + Intronic
1018974676 6:168555850-168555872 GAGGACCGCGCAGGAGACAAGGG - Intronic
1019314074 7:376564-376586 GAGGACGGAGCAGGAGACAGCGG - Intergenic
1019389475 7:777882-777904 CTGGAGCGGGCAGAGGACACGGG + Intronic
1019479627 7:1260466-1260488 CTGGATGGGGCAGGAGAAACAGG + Intergenic
1019536811 7:1533639-1533661 GTGGTCCAGACAGGAGACGCTGG + Intronic
1019923375 7:4177018-4177040 GTGGACCAGGCAGGAGGGAGGGG + Intronic
1020080761 7:5284595-5284617 GGGGACAGGGCAGGAGGCCCTGG + Intronic
1020884420 7:13804095-13804117 GTGTCCCAGTCAGGAGACACGGG - Intergenic
1024334759 7:48195994-48196016 GTGTACTGTGCAGGAGAAACGGG + Intronic
1024334976 7:48197559-48197581 GTGTACTGTGCAGGAGAAACGGG + Intronic
1024473514 7:49787726-49787748 GTGGCCTGGGCAGGAGAAGCAGG + Intronic
1025111831 7:56223603-56223625 GTGGACCGGGTGGGGGTCACAGG + Intergenic
1025198165 7:56947582-56947604 GGGGACAGGGCAGGAGGCCCTGG - Intergenic
1025673784 7:63629354-63629376 GGGGACAGGGCAGGAGGCCCTGG + Intergenic
1025731939 7:64115045-64115067 CTGGATCGGGAAGGAGACCCTGG + Intronic
1025798919 7:64765890-64765912 GTGATCCAGGCAGGAGACTCAGG - Intergenic
1026895407 7:74007429-74007451 GGGGATGGGGCAGCAGACACTGG - Intergenic
1032517702 7:132519259-132519281 ATGGACTGGGTAGGAGACAGTGG - Intronic
1033318174 7:140315731-140315753 GTGGACCAGCCAAGAGGCACGGG + Intronic
1034269434 7:149796533-149796555 GTGGGCAGGGCAGGAGAGAGAGG + Intergenic
1034582255 7:152055011-152055033 GTGGAGCAGGCCAGAGACACAGG + Intronic
1035081804 7:156222390-156222412 GTGCACCTGGCTGGGGACACTGG + Intergenic
1035403456 7:158583764-158583786 GGAGACCGAGCAGGAGAGACAGG + Intronic
1035698896 8:1622925-1622947 GTGGCCCCGCCAGGTGACACAGG - Intronic
1039128924 8:34238692-34238714 GTGGACGGCAAAGGAGACACAGG + Intergenic
1041078038 8:54187029-54187051 GTGGAGAAGGCAGGAGACAAAGG - Intergenic
1043936354 8:86147221-86147243 GTGCACCTGGCAGGAGGCAGTGG - Intronic
1045064939 8:98436331-98436353 GGGCGTCGGGCAGGAGACACAGG - Intronic
1047509486 8:125505626-125505648 CAGAACCTGGCAGGAGACACAGG - Intergenic
1049527144 8:143133091-143133113 GTGGAGTGGGCTGGAGACCCTGG - Intergenic
1049536785 8:143186203-143186225 GAAGACCGGGCAGGAGCCGCGGG - Intergenic
1049864295 8:144923920-144923942 GTGGACTGTGCAGGGGCCACAGG - Intergenic
1050109395 9:2199501-2199523 GTGGACAGGGAAGGGGAAACAGG + Intergenic
1051221953 9:14858182-14858204 GTGGACCTGGAAGGATACGCAGG - Intronic
1056856258 9:90132143-90132165 GTGGGCCGGGGAAGAGGCACTGG - Intergenic
1057230738 9:93319938-93319960 GTGGACCGGGCAGGAGACACTGG - Intronic
1060036112 9:120257110-120257132 GTGGGTGGGGCAGGGGACACTGG - Intergenic
1061089219 9:128417499-128417521 GGGGAGTGGGCAGGGGACACAGG + Intronic
1061177431 9:129006222-129006244 AGGGACCTGGGAGGAGACACAGG - Exonic
1061905393 9:133694174-133694196 GTGGACAGGGCAGGATGGACGGG - Intronic
1062365068 9:136204545-136204567 GTGGTTCAGGCGGGAGACACAGG + Intronic
1062526748 9:136980998-136981020 CAGGGCCGGGCGGGAGACACTGG + Intronic
1062630806 9:137462350-137462372 GGGGCCGGGGCAGGAGACTCAGG - Intronic
1203571519 Un_KI270744v1:136808-136830 GTGATCCAGGCAGGAGACTCAGG + Intergenic
1185505749 X:631342-631364 GTGGACCCGACCGGAGACGCGGG + Intronic
1186516321 X:10168362-10168384 GTGCAGCGGGCAGAGGACACGGG - Intronic
1186954307 X:14664821-14664843 GGGGTCAGGGAAGGAGACACTGG + Intronic
1189332631 X:40152969-40152991 GGTGACCGGGCTGGAGACCCAGG + Intronic
1194866512 X:99075360-99075382 CTGGACTGGGCAGGAGACACTGG - Intergenic
1196649903 X:118158032-118158054 GTGGAGCGGGGAGGAGACAGGGG + Intergenic
1198090280 X:133322103-133322125 GTGGACTGGCCAGGATACACGGG - Intronic
1198106635 X:133468244-133468266 GTGGACTAGGCAGGCCACACAGG + Intergenic
1200092586 X:153642803-153642825 GTGCAAGTGGCAGGAGACACGGG - Intronic
1200106405 X:153715695-153715717 GTGGAGCAGAGAGGAGACACGGG + Intronic
1200167979 X:154050503-154050525 GAGGACTTGGCAGGAGGCACAGG + Intronic
1201329543 Y:12803173-12803195 GTGGCCCTGGCAGCAGTCACTGG + Intronic