ID: 1057232458

View in Genome Browser
Species Human (GRCh38)
Location 9:93332067-93332089
Sequence CTCCAGAGGGCCTGGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057232458_1057232462 -8 Left 1057232458 9:93332067-93332089 CCACATCACCAGGCCCTCTGGAG 0: 1
1: 0
2: 1
3: 32
4: 295
Right 1057232462 9:93332082-93332104 CTCTGGAGTCTTCAATTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057232458 Original CRISPR CTCCAGAGGGCCTGGTGATG TGG (reversed) Intronic
900152083 1:1183153-1183175 CTGCACAGGGGCTGGTGGTGCGG - Intronic
900313569 1:2046376-2046398 CTCCTGGGGGTGTGGTGATGGGG + Intergenic
900357196 1:2270676-2270698 CTCCAGAGGGGCTGGAGGTGGGG + Intronic
900590951 1:3459588-3459610 CTCCAGAGGGCCCAGTGCTCTGG - Intronic
900637802 1:3674482-3674504 GTCCGCAGGGCCTGGTGAGGAGG - Intronic
901470402 1:9452069-9452091 CTCCCGAGGGCCGGGCGCTGGGG + Intergenic
901769730 1:11524180-11524202 CTGCAGAGGAGCTGGGGATGGGG + Intronic
901919463 1:12525941-12525963 CTCCAGAGGCCCAGGAGAGGTGG + Intergenic
902556207 1:17248347-17248369 ATCCAGAGGGCCGGGTGCTGTGG + Intergenic
903185302 1:21625458-21625480 GACCAGAGGGCCTGGTGTTAGGG - Intronic
903480727 1:23651416-23651438 CTCCAGAGGGACTGGGGTGGAGG + Intergenic
904246618 1:29192622-29192644 GTACAGAGGGCCAGGTGATAAGG + Intergenic
905580001 1:39076988-39077010 CTCCACAGGGCCAGGTCCTGTGG - Intergenic
906778976 1:48555679-48555701 CTCCTGTGGCCCTGGTGAAGTGG + Intronic
907448168 1:54523111-54523133 CTCCAGAGGGCTGGGTGAGGTGG + Intergenic
907817982 1:57938758-57938780 CTCCAGGGGGCCTGGGGAAGGGG - Intronic
912422047 1:109548993-109549015 CCCCAGAGGGCGTGATGAGGGGG + Intronic
912471964 1:109912264-109912286 CTCCAGAGGCCTTGTTGAGGGGG + Intronic
915466855 1:156103269-156103291 TTCCAGAGGGCCTGTGGCTGAGG + Intronic
915732411 1:158063386-158063408 CTCCTGAGGGCATGGACATGGGG - Intronic
917444123 1:175092309-175092331 CTCCAGAGGCCCTGGCCATGGGG + Intronic
918450474 1:184652726-184652748 CTGGAGAGGCCCTGGTGGTGAGG - Intergenic
922232361 1:223698198-223698220 CTCCAGAGGGCTTTGGGATCTGG + Intergenic
922586136 1:226736424-226736446 CCCCAGAGGCCCTGGTGGAGAGG - Exonic
922678826 1:227572777-227572799 CTCCAGAAGGCCTTGCCATGTGG - Intronic
923567897 1:235090480-235090502 CTGCACAGGGCCTGGGGATGTGG - Intergenic
1063648322 10:7908226-7908248 ATTCAGAGGGCCTAGTGGTGGGG + Intronic
1064427536 10:15243383-15243405 ATCCACAGGGCCTGGAGATTAGG + Intronic
1065483038 10:26213588-26213610 CTCCAGAAGGCCTGGGTTTGTGG + Intergenic
1067237825 10:44466597-44466619 CTGCACTGGGCCTGGTCATGAGG + Intergenic
1067246643 10:44552930-44552952 CTACAGATGGCCTGGTGAGTGGG + Intergenic
1068023943 10:51619138-51619160 CTCCAGAGGAAGTGGTGAGGGGG + Intronic
1071489689 10:86127919-86127941 CTTGAGAGGGCCTGGTGCAGGGG - Intronic
1071492264 10:86143957-86143979 ATTGAGAAGGCCTGGTGATGGGG - Intronic
1073330659 10:102668243-102668265 CTTCAGAGGCCCTGCTGCTGTGG - Intergenic
1075129614 10:119726450-119726472 CGCCTGCGGGCCTGGTGAGGCGG + Intronic
1076022666 10:127087069-127087091 CTCCAGAAGGCCAGGGGATGTGG + Intronic
1076377714 10:130002781-130002803 GTCCAGAGGGCCGGGTGCAGCGG - Intergenic
1076470721 10:130716377-130716399 GTCCAGAAGACCTGGTGATGGGG - Intergenic
1076711385 10:132337192-132337214 CTGCCGAGGGCCAGGTGCTGCGG + Intronic
1076902636 10:133347514-133347536 CTCCAGGGGGCCTGGTTCAGGGG + Intronic
1077163947 11:1126746-1126768 CTCCAGATGCCCTGGTGGTGGGG + Intergenic
1077213979 11:1387595-1387617 TTCCAGCGGGCCTGGTACTGGGG - Intergenic
1077432373 11:2522210-2522232 CCCAAGAGGGCGTGGTCATGCGG - Intronic
1077454843 11:2672312-2672334 CTCAAGGGGGCCTGGTGTGGTGG + Intronic
1078327678 11:10393783-10393805 CTCCAGAGGGCCAGGAAAGGGGG + Intronic
1079551559 11:21705211-21705233 ATGTAGAGGGCCTGATGATGTGG - Intergenic
1081575333 11:44315579-44315601 CTGCACAGGGCTTGCTGATGTGG - Intergenic
1081585824 11:44382920-44382942 CTCCAGAGGACTTGGTGGAGGGG - Intergenic
1084693277 11:70739192-70739214 AGCCAGAGGGCCTGATGGTGGGG + Intronic
1085530494 11:77189552-77189574 CTCCAAAGGGCCTGGTCACAAGG + Intronic
1087613176 11:100458151-100458173 CTCCAGAGGGATTGGATATGGGG + Intergenic
1089766943 11:120774902-120774924 CAGCAGAGGGCCTACTGATGCGG + Intronic
1090696661 11:129251150-129251172 CTCCAAAGGTGCTGATGATGAGG + Intronic
1091670667 12:2449941-2449963 CTACAGGGGGCCTGGTTCTGTGG + Intronic
1092140379 12:6179477-6179499 AACCAGAGGGCCTGGAGAGGAGG + Intergenic
1092991542 12:13907201-13907223 CTCCAGAGGGCCGGGCGTGGTGG + Intronic
1094578934 12:31715353-31715375 ATCCAGAGATCCTGGTGATGAGG - Intronic
1095266400 12:40163611-40163633 TTCTAGTGGGCCTGATGATGGGG + Intergenic
1096100677 12:48969130-48969152 CCCCACAGGGCCTGGTGTAGGGG - Intronic
1096244750 12:49978102-49978124 CTCCTGAGGGACTGGGGATGGGG + Intronic
1096407453 12:51354288-51354310 CTCCAGAGAAGCTGGTGATCAGG + Exonic
1096629229 12:52915016-52915038 CTCCACAGGGTCTTGTTATGTGG - Intronic
1096674579 12:53219693-53219715 CTCCAGAGTTCCTGGGGATAGGG - Intronic
1097229518 12:57501286-57501308 CTTCACAGGCCCTGGTGATCTGG - Intronic
1098917205 12:76269853-76269875 TTCCAAAGTGCCTGGGGATGGGG + Intergenic
1100346137 12:93733526-93733548 TTCCAGACGGCTGGGTGATGGGG - Intronic
1103289887 12:119836473-119836495 CTCCATAGGCCCTGGGTATGTGG + Intronic
1103443639 12:120980418-120980440 CTCCCGAGGGCCTGGACAGGGGG + Intronic
1103967020 12:124646450-124646472 CTCCAGAGGCCCTGGAGACTAGG - Intergenic
1104724944 12:131070269-131070291 CTGCTGAGGGCCTGGTTTTGCGG - Intronic
1105278563 13:18950125-18950147 TTGCAGGGGGCATGGTGATGGGG - Intergenic
1107707764 13:43123970-43123992 CCCCGAAGGGCATGGTGATGTGG - Intergenic
1110513460 13:76381242-76381264 TTACAGAAGGCCTGCTGATGGGG - Intergenic
1110682608 13:78334255-78334277 CACCAGAGGGCGTGGCCATGGGG - Intergenic
1111758534 13:92431623-92431645 CTACAGAGGCCATGGTGAGGAGG + Intronic
1112331433 13:98479735-98479757 CTCGAGGGGGCCCGGTGCTGTGG + Intronic
1113572433 13:111368254-111368276 ATCCAGAGGACCTGGAGAGGTGG - Intergenic
1113883901 13:113647304-113647326 GTTCTGAGGGCCTGGAGATGGGG + Intergenic
1113952875 13:114081390-114081412 TTCCAGAGTGCTGGGTGATGCGG - Intronic
1114063269 14:19038564-19038586 ATCCAGAGGACCTGGTCCTGAGG - Intergenic
1114098986 14:19361431-19361453 ATCCAGAGGACCTGGTCCTGAGG + Intergenic
1114664350 14:24369211-24369233 GTCCAGAGGGGCTGGAGCTGGGG - Intronic
1119504313 14:75158635-75158657 CTTCAGAGGGCCGGGTGTGGTGG + Intronic
1120112035 14:80568554-80568576 CACTAGAGGGGCTGCTGATGAGG + Intronic
1120415802 14:84216774-84216796 ATCCAGAGTGCCTGGGGGTGGGG + Intergenic
1120770209 14:88370754-88370776 CTCCAGAAGGCCTGCAGAAGAGG + Intergenic
1121220007 14:92278034-92278056 CTCCACAGAGCCTGGGGGTGGGG + Intergenic
1122161355 14:99786542-99786564 CTGCAGAGGCCCTGTTGATGGGG + Intronic
1122347998 14:101072256-101072278 TGCCAGCGGGCCTGGTGATTCGG + Intergenic
1123493280 15:20799621-20799643 TTCCAGAGGACCTGGTCCTGGGG + Intergenic
1123549787 15:21368723-21368745 TTCCAGAGGACCTGGTCCTGGGG + Intergenic
1123983468 15:25623860-25623882 CTGGGGAGGGGCTGGTGATGAGG - Intergenic
1124419288 15:29505640-29505662 CTCCAGAAGACCTGAAGATGAGG + Intronic
1126875715 15:53038844-53038866 CTCCAGAGACCCTGCTGTTGAGG + Intergenic
1127328589 15:57917927-57917949 CTTCAGAGGGCCTGCCGAGGAGG + Intergenic
1128329173 15:66744784-66744806 CACTAGAGGGACTGGCGATGAGG - Intronic
1129532265 15:76277864-76277886 CTCCACAGGAGCTGGTGGTGGGG - Intronic
1129555146 15:76500483-76500505 CTGGAAAGGGCTTGGTGATGTGG + Intronic
1130911845 15:88276225-88276247 CTCCAAAGCTCCAGGTGATGGGG + Intergenic
1131527046 15:93160648-93160670 CTCCTGAGGTTGTGGTGATGGGG - Intergenic
1202958118 15_KI270727v1_random:95941-95963 TTCCAGAGGACCTGGTCCTGGGG + Intergenic
1132561614 16:597217-597239 TTACAGAGGGCTTGGTGCTGGGG + Intronic
1134209536 16:12264492-12264514 CTCCACAGGGCCGGGTGCTGTGG + Intronic
1136496465 16:30648098-30648120 CTCCAGTGGGGCTGCTGGTGTGG - Intergenic
1137730188 16:50683913-50683935 CAGCAGAGGGCCTGGTGGTGTGG + Intergenic
1137788375 16:51154722-51154744 CGCCAGAGGGCCTGGTACTTAGG + Intergenic
1138277269 16:55744172-55744194 CTCCAGTGGTCCTGGTTATAGGG - Intergenic
1140072452 16:71663028-71663050 CTGCACAGAGCCTGGGGATGGGG - Intronic
1140092910 16:71852005-71852027 CCCCAGAGGGTGTTGTGATGGGG + Exonic
1140187817 16:72789986-72790008 CCCATGAGGGCCTGGTGATATGG - Intronic
1140229844 16:73108655-73108677 CTCCACAGGGCCTGATGGGGAGG - Intergenic
1141169146 16:81680319-81680341 CTTCTGAGGGCCTGGTGAGCTGG + Intronic
1141344807 16:83234703-83234725 CTCCAGAGGGGCTGGGGGTAGGG - Intronic
1142474824 17:182496-182518 CTGCACAGGGCCTGGTCAGGAGG + Intergenic
1143270967 17:5674009-5674031 CTCAAGAGTGCCTTGTGTTGGGG + Intergenic
1143621448 17:8082841-8082863 CTACAAAGTGCCTGGTGTTGGGG - Intronic
1143736280 17:8914009-8914031 CTCCAGAGGGTCTTGTGGTCGGG - Intronic
1144954917 17:19014316-19014338 CTCAAGAGGGCCTGAGGGTGAGG - Intronic
1145883378 17:28367336-28367358 CTACAGAGGGCCCGGCCATGTGG + Exonic
1146492104 17:33291064-33291086 GTCCTGAGGGCCTGGAGTTGAGG + Intronic
1146581570 17:34043169-34043191 CTCCAGGGATGCTGGTGATGCGG + Intronic
1148740482 17:49889938-49889960 CTCCAAAGTGACTGGTGATGTGG - Intergenic
1151624577 17:75268708-75268730 ATACAGAGGGCCTGGTGTGGTGG + Intronic
1151655476 17:75493932-75493954 GTCCAGCGGGGCTGGTGCTGGGG + Intronic
1151815112 17:76467984-76468006 CTGCAGAGGGCCTGGGGAATGGG - Intronic
1152034738 17:77865152-77865174 CTGCAGAGGGGGTGGTGCTGTGG - Intergenic
1152655415 17:81517170-81517192 CTCCAGAAGGCCTGGAGCAGCGG - Intronic
1152741072 17:82018542-82018564 CTCCACAGCGCCTGGGGGTGGGG + Intergenic
1154450833 18:14474159-14474181 TTCCAGAGGACCTGGTCCTGCGG + Intergenic
1156258571 18:35423024-35423046 CTGCAGGGGACCTGGTAATGAGG + Intergenic
1156499064 18:37545433-37545455 CTCCAGGGGGCCCAGAGATGAGG + Intronic
1157564911 18:48673218-48673240 CTCTAGAGCACCTGGTGCTGGGG - Intronic
1158201620 18:54947988-54948010 CTCCTGGGTGCCTGGTGGTGTGG - Intronic
1158508157 18:58065350-58065372 CTCTAGAGTGCCTGGCGAGGTGG + Intronic
1160975002 19:1788853-1788875 CCCCAGAGGCCCTGGTCATGGGG + Intronic
1161664319 19:5565677-5565699 CTCAAGAGGGCCTGGGGAGGGGG + Intergenic
1162791799 19:13066858-13066880 AGCCAGAGGGCCGGGGGATGAGG - Intronic
1163602696 19:18258328-18258350 CTGCAGAGGGCCTGTGGGTGGGG + Intronic
1163677215 19:18661082-18661104 CTCCAGCGGCCCTGGGGCTGGGG + Intronic
1163691625 19:18741713-18741735 CTCTCGAGGGCCTGGGGGTGAGG - Intronic
1163796670 19:19341974-19341996 CTCCACAGGGCTTGGTAAGGGGG + Intronic
1165091546 19:33390745-33390767 CCCCAGAATGCCTGGGGATGAGG + Intronic
1165181815 19:33978205-33978227 GGCCAGAGAGCCTGGTCATGTGG - Intergenic
1165406277 19:35633127-35633149 CCCACGAGGGCCTGGTGAGGGGG - Exonic
1166703019 19:44893026-44893048 CTACCGAGAGCCTGGAGATGGGG + Intronic
1167374444 19:49103512-49103534 CTCCTGGGGGCCTGGCGAGGAGG - Intronic
925417128 2:3678189-3678211 CCACAGAGTGCCTGGTGATGTGG + Intronic
925910270 2:8569374-8569396 CTCCAGAGGGAGTGGTGAGTGGG - Intergenic
926367996 2:12151219-12151241 CTCCAGGGGGGCTAGTGATTGGG + Intergenic
927848610 2:26485017-26485039 CCCCAGAGGGGCTGAAGATGGGG - Intronic
928103847 2:28454987-28455009 ATCCAGATGGCCTGGTGATACGG + Intergenic
928157138 2:28887156-28887178 CTCAACAGGGCCTGGTGCAGTGG + Intergenic
929809267 2:45175255-45175277 TTCCAGTGGGCCTGGGCATGTGG - Intergenic
929891021 2:45918725-45918747 CTGCAGTGGGCCTGGGGCTGAGG + Intronic
930025910 2:47029052-47029074 CCCCAGATGGCCTGGCGAGGAGG - Intronic
930388126 2:50723621-50723643 ACCCAGAGGGCCTGGGGAAGAGG + Intronic
930610654 2:53539368-53539390 AACCAGTGGGCCTGGTAATGTGG - Intronic
932165138 2:69498787-69498809 CTCCAGAGGCCCTTGAAATGTGG + Intronic
932360402 2:71100668-71100690 CTCCTGAGAACCTGGGGATGAGG - Intergenic
932446639 2:71785777-71785799 CTCCCGACGGCCTGCTGCTGGGG + Intergenic
933095832 2:78179454-78179476 CTCCACAGAGCCTGGAGGTGGGG + Intergenic
933720385 2:85393977-85393999 GTCCAGAGGACCTGGGGGTGAGG + Intergenic
933750876 2:85601652-85601674 TTCCAGAGGGCCTGTAGCTGGGG - Intronic
934475003 2:94587829-94587851 CTCCTGAGGGGCTGGAGCTGGGG + Intergenic
935070935 2:99692797-99692819 CTCCAGAGAGCCAGGTTATCAGG + Intronic
935317315 2:101848588-101848610 CCCCAGTGGGCCTGGTTTTGTGG - Intronic
937434740 2:121871085-121871107 CTGCAGAGAGCCTGGGGAGGAGG - Intergenic
937639138 2:124192010-124192032 CTACAGAGGACCTGGTGATGGGG + Intronic
938292173 2:130156121-130156143 CCCCACAGGTCCTGGAGATGTGG - Exonic
938383777 2:130850699-130850721 CTTCAGATGCCCTCGTGATGGGG + Intronic
938464379 2:131516849-131516871 CCCCACAGGTCCTGGAGATGTGG + Intergenic
940102188 2:150054145-150054167 CTCCACAGGGTCGAGTGATGAGG + Intergenic
942551648 2:177126135-177126157 CTCCAGAGGGCCAGCTAAGGAGG + Intergenic
945151993 2:206801347-206801369 TCCTTGAGGGCCTGGTGATGGGG + Intergenic
948427083 2:237895100-237895122 CTCCAGAGGCCATGGTGCTGGGG - Intronic
948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG + Intronic
948840292 2:240645408-240645430 GTCCTTAGGGCCTGGTGCTGGGG - Intergenic
948890872 2:240906525-240906547 CTCCAGTGAGCCTGGCAATGGGG + Intergenic
1168952421 20:1811466-1811488 GTCCAGATGGCCTGGTGAGGTGG + Intergenic
1169208411 20:3752668-3752690 CTCCAGAGGGACAGGTGTGGTGG + Exonic
1169281024 20:4267069-4267091 CTCCTGAGGGCCAGGTGCAGTGG - Intergenic
1172389584 20:34558111-34558133 CACCAGAGAGACAGGTGATGGGG - Intronic
1172522798 20:35579173-35579195 CTCCAGAGGGCCCTCCGATGGGG - Intergenic
1172716660 20:36969306-36969328 CTCCAGAGGACCTGGGGCTTGGG + Intergenic
1173170127 20:40716931-40716953 CCTCAGAGGGCTTAGTGATGTGG - Intergenic
1174506651 20:51021864-51021886 CTCCTTAGGGGCGGGTGATGGGG - Intronic
1175822278 20:61916745-61916767 CTGCAGAGGGGATGGTGAGGAGG + Intronic
1176235972 20:64053731-64053753 CTCCCAGGGCCCTGGTGATGTGG + Intronic
1179173485 21:38990946-38990968 GTCCAGAGGTCCTGGTGACCTGG + Intergenic
1179219048 21:39390242-39390264 CTCCAGACTGCCTGGAGATGGGG + Intronic
1179376906 21:40857707-40857729 CTCCAGAAGGCCGGGCCATGGGG + Intergenic
1179496214 21:41772743-41772765 GTGCAGAGGGCCTGGGGAGGAGG - Intergenic
1179528771 21:42003305-42003327 CACAAGAGGTGCTGGTGATGGGG + Intronic
1180481761 22:15761193-15761215 ATCCAGAGGACCTGGTCCTGAGG - Intergenic
1180840010 22:18954820-18954842 CATCAGGGGGCCTGGTGCTGGGG - Intergenic
1181061890 22:20285660-20285682 CATCAGGGGGCCTGGTGCTGGGG + Intergenic
1181547390 22:23609838-23609860 CTCCAGAGGGCTTGGAGAAAAGG - Intronic
1182087213 22:27569424-27569446 CTGGAGAGGGCCTGGGGCTGGGG - Intergenic
1182666319 22:31962815-31962837 GTCCAGATTGCCTGGAGATGTGG - Intergenic
1182749605 22:32631004-32631026 CTGCAGAGGGCCGGGTGTGGTGG + Intronic
1183102534 22:35592705-35592727 TTCCAGAGGGCTTTGTGCTGGGG + Intergenic
1183462272 22:37959034-37959056 GAGCAGAGGGCCTGGAGATGGGG - Intronic
1183478765 22:38051386-38051408 CTGCAGAGTGGCTGGTGATGGGG - Intergenic
1184334930 22:43847542-43847564 CTCCTGAGGTCCCAGTGATGTGG + Intronic
1184382227 22:44152105-44152127 ATTCAGAGGTCCTGGTGATTAGG + Intronic
1184676662 22:46046694-46046716 CCCCAGAGGGTTTGGGGATGGGG - Intergenic
1184749281 22:46475185-46475207 ATGCTGAGGGCCTGGGGATGTGG - Intronic
1185227386 22:49660798-49660820 CTGCAGCGCGTCTGGTGATGTGG - Intergenic
950520370 3:13494601-13494623 CGCCAGAGGGCCTGGGCTTGTGG + Intronic
950523206 3:13508535-13508557 TGCCAGAGGGCCTGGCCATGGGG - Intergenic
950708404 3:14797985-14798007 CTCCAGAGGCCCTGAAGATCAGG + Intergenic
951022347 3:17794007-17794029 CTGAAGAGGGTCTGGTGCTGGGG + Intronic
954155251 3:48681754-48681776 CCCCGGAGGGCATGGTGTTGTGG + Exonic
954361935 3:50126688-50126710 CTGCAGCTGGCTTGGTGATGGGG - Intergenic
955344857 3:58153400-58153422 GGCCAGAGGGGCTGGTGACGTGG - Exonic
961865431 3:129950290-129950312 TTCTAGAGGGCCTGGGGATGAGG + Intergenic
962253400 3:133853435-133853457 CTCCACAGGCCCTTGGGATGGGG + Intronic
962494418 3:135924820-135924842 CTCCAGAGGGCCAGCAGAAGGGG - Intergenic
963171724 3:142257786-142257808 CTGCAGAGGGGCTGGGGGTGGGG + Intergenic
963239151 3:142985616-142985638 ATGCAGAGGGCCTTGTTATGAGG + Intronic
965683216 3:171273332-171273354 CTGTAGTGGGCCTGGTGTTGGGG + Intronic
966594125 3:181711404-181711426 CACCAGAGGGGCTGGAGTTGGGG + Intergenic
967391253 3:188957193-188957215 CTCCAGAGTCGCTGGTGTTGGGG - Intronic
969589578 4:8114168-8114190 CTCCCTAGGGCCAGGTGCTGAGG + Intronic
970184185 4:13431573-13431595 CTCCTGTGGGCCTGATGGTGTGG - Intronic
970460033 4:16265489-16265511 CACAAGAAGGCTTGGTGATGGGG - Intergenic
971518888 4:27524332-27524354 ATGCAAAGGGCCTGGTGTTGAGG + Intergenic
973245569 4:48007507-48007529 ATCAAGAGGGCCTGAAGATGAGG + Intronic
974785013 4:66609050-66609072 CTGCATAGGGCCTTGTGATGCGG + Intergenic
975106379 4:70572653-70572675 CTCTGAAGGGCCTGGTGAAGTGG + Intergenic
975438315 4:74380199-74380221 CTCCAGAGAACCTGATGGTGAGG - Intronic
976974214 4:91147149-91147171 CTGCAGTTGGTCTGGTGATGCGG + Intronic
978329627 4:107598501-107598523 CTACAGAGGGCCGGGTGCAGTGG + Intronic
980136956 4:128867328-128867350 TTCCAGTGGGCCTGGTGCAGGGG + Intronic
986267016 5:6199532-6199554 CTCCAAGGGGCCTGGTGAGGAGG + Intergenic
986286044 5:6359976-6359998 CTGCAGAGGGGCTGCTGATGAGG - Intergenic
989418928 5:41212554-41212576 CTCCAGAATGCCTAGAGATGTGG - Intronic
994793200 5:104258533-104258555 CTCCAGGGGGCCTAGTAATCAGG + Intergenic
997201843 5:132014673-132014695 CTCCAGAGGGTGTGGATATGGGG + Intergenic
998358829 5:141566555-141566577 CCCCAGTGGGCTTGGAGATGGGG - Intronic
998707507 5:144780096-144780118 CTCCAGAGCTCCTCTTGATGAGG - Intergenic
1001611314 5:173004395-173004417 CTTCAGAGAGCCTGGTGAGAAGG + Intronic
1002457991 5:179356554-179356576 CTGCAGAGGGGCTGGAGAAGCGG - Intergenic
1002918260 6:1546360-1546382 ATCCAGAGGACTTGGTGATATGG - Intergenic
1003954456 6:11148852-11148874 CTCCTGAGGTCCTGGTGTTGAGG - Intergenic
1004538109 6:16522454-16522476 CTCCAAAGGACCCAGTGATGAGG + Intronic
1005115072 6:22327069-22327091 AGCAAGAGGGCCTGTTGATGTGG + Intergenic
1005371064 6:25133682-25133704 TTCTAGGGGGCCTGGAGATGAGG - Intergenic
1006101495 6:31688770-31688792 CTCTAGGGGGCCTGGTGACCAGG - Exonic
1006142767 6:31940616-31940638 CCCCCGAGGGCCAGGTGATGGGG - Intronic
1007777841 6:44233664-44233686 CTCCCCAGGGCCTGGAGATCCGG - Exonic
1010109767 6:72212829-72212851 CTTCGGTGGGCCTGGTGGTGTGG - Intronic
1010600929 6:77825485-77825507 CTCCTGTGGGCTTGGAGATGGGG - Intronic
1016429648 6:143969349-143969371 CTCAAAAGGGTCTTGTGATGTGG - Intronic
1018071573 6:160168513-160168535 GTGCAGAGGGCCTGGTGCAGAGG - Intergenic
1018080560 6:160256178-160256200 CTACATTGGGCCTGGTGCTGGGG + Intronic
1019930080 7:4217213-4217235 CTCCAGGTGGCCTGGTGCTCTGG - Intronic
1019930207 7:4217621-4217643 CTCCAGGTGGCCTGGTGCTCCGG - Intronic
1020057295 7:5126794-5126816 CTGCAGGGGGCCGGGGGATGAGG - Intergenic
1020170459 7:5840870-5840892 CTGCAGGGGGCCGGGGGATGAGG + Intergenic
1021678263 7:23103418-23103440 ATCTAGTGGGCATGGTGATGTGG + Intergenic
1022496388 7:30855617-30855639 ATGCAGAGGTCCTGGTGCTGAGG - Intronic
1022728701 7:33003373-33003395 ATCCAGAAGGGCTGATGATGTGG - Intronic
1024975789 7:55112570-55112592 CTCCACAGGGCCTTCTGAGGGGG - Intronic
1026011982 7:66643564-66643586 CTCCAGGGGGCATCTTGATGAGG - Intronic
1028532336 7:91851732-91851754 TTGCAGGGGGTCTGGTGATGTGG - Intronic
1030696096 7:112587554-112587576 GACCTGAGGCCCTGGTGATGTGG - Intergenic
1032768578 7:135024217-135024239 CCAGAGCGGGCCTGGTGATGGGG + Intronic
1033244771 7:139708435-139708457 CCCCAGAGGGCCTGCTCATTAGG + Intronic
1034422818 7:150998271-150998293 CTCCAGAGGAGCTGCTGGTGAGG - Intronic
1035258295 7:157646138-157646160 CTCCGCATGGCCTTGTGATGTGG + Intronic
1035315723 7:157996865-157996887 CTCCTGAGGGCCTGGCGTGGGGG - Intronic
1035689419 8:1550026-1550048 TACCAGAGGGACTGGGGATGGGG - Intronic
1035837137 8:2766411-2766433 CTCATGAGGGCCTGAAGATGGGG - Intergenic
1036657834 8:10689149-10689171 CTACACAGGGAGTGGTGATGGGG + Intronic
1036695950 8:10975272-10975294 CTCCTGAAGGCTGGGTGATGGGG - Intronic
1037605696 8:20435531-20435553 CCACGGAAGGCCTGGTGATGGGG + Intergenic
1037626223 8:20609352-20609374 CTCTGGAGGGGGTGGTGATGAGG + Intergenic
1037834658 8:22208886-22208908 AGCCAGAGGGCCTGGGGAGGAGG + Intronic
1039365316 8:36922654-36922676 CTGCAGAGGGCTTGGTTTTGGGG - Intronic
1039740631 8:40379524-40379546 CTGCAGAGAGTCTGGTGAGGGGG + Intergenic
1042386117 8:68176777-68176799 CTCCAGGGTGCTTGGTGTTGAGG + Intronic
1044944209 8:97375775-97375797 CGCCAGAGGGCCAGGTTGTGGGG - Intergenic
1045003702 8:97899707-97899729 CTCCTGAAGGCCTGGGGGTGAGG + Intronic
1048886634 8:138914476-138914498 CACCAGGGGGCCTGGGGAGGGGG + Intergenic
1049337257 8:142093057-142093079 CACCAGAGGGCGGGGTGAGGAGG - Intergenic
1051360938 9:16281057-16281079 CCCCTGAGGGCCGGGTGCTGTGG + Intergenic
1052374134 9:27698626-27698648 ATCCATAGGGCCTGGGGGTGGGG + Intergenic
1052855048 9:33401931-33401953 CTCCTGAGGGGCTGGAGCTGGGG - Intronic
1052985720 9:34485924-34485946 CTCCAGTGGGGCTGGGGGTGGGG - Intronic
1053683066 9:40498272-40498294 CTCCTGAGGGGCTGGAGCTGGGG - Intergenic
1053933049 9:43126588-43126610 CTCCTGAGGGGCTGGAGCTGGGG - Intergenic
1054280648 9:63126656-63126678 CTCCTGAGGGGCTGGAGCTGGGG + Intergenic
1054296166 9:63333770-63333792 CTCCTGAGGGGCTGGAGCTGGGG - Intergenic
1054394182 9:64638275-64638297 CTCCTGAGGGGCTGGAGCTGGGG - Intergenic
1054428832 9:65143474-65143496 CTCCTGAGGGGCTGGAGCTGGGG - Intergenic
1054501547 9:65878061-65878083 CTCCTGAGGGGCTGGAGCTGGGG + Intronic
1055074002 9:72194981-72195003 CCCCCCAGGGCGTGGTGATGTGG - Intronic
1057011461 9:91606149-91606171 ATCCAGTGTGACTGGTGATGAGG + Intronic
1057232458 9:93332067-93332089 CTCCAGAGGGCCTGGTGATGTGG - Intronic
1057577623 9:96255879-96255901 CTCCAGAGGGCTGCGTGAAGGGG + Intronic
1057974461 9:99590003-99590025 TTGCACAGGGCCTGGGGATGGGG + Intergenic
1058475543 9:105329016-105329038 TTCCAGAGGGGCTGGTGTTGGGG - Intronic
1060010800 9:120041397-120041419 CTCCAGAGGCCCTGGTTGTAAGG - Intergenic
1060823455 9:126674269-126674291 TTCCACAGGGCATGGTGTTGGGG - Intronic
1061079839 9:128363410-128363432 CTCCATAGGGCCGGGTGCGGCGG - Intergenic
1061235795 9:129341919-129341941 CTCCAGAGGGCCTCGTGGGGAGG - Intergenic
1061460804 9:130736985-130737007 CTCCAGAGGACCTGCTGAGTAGG + Intronic
1062218868 9:135403717-135403739 AACCAGAGAGCCTGGGGATGAGG - Intergenic
1187154606 X:16711984-16712006 CTCCCGAGGGCCGGGAGAAGTGG + Exonic
1187370216 X:18699195-18699217 CACCAGAGGGCCTCATTATGAGG - Intronic
1189441966 X:41045366-41045388 CTCCAGCTGGCCGGGTGCTGTGG + Intergenic
1189885735 X:45542534-45542556 CTCCAGAGAGGCTGATGAGGGGG - Intergenic
1191252205 X:58265083-58265105 CCCCAGCGGGCCTGGTGCAGGGG - Intergenic
1192195267 X:69023733-69023755 CTCCATGGGGCCTGGTAGTGAGG + Intergenic
1192289647 X:69780522-69780544 CTCCTGAGGACCTGGTGATTTGG + Intronic
1192602703 X:72481535-72481557 CTCCTTTAGGCCTGGTGATGTGG - Intronic
1193106199 X:77676832-77676854 CTAAAGAGGGCCGGGTGAGGTGG + Intronic
1195989431 X:110667966-110667988 AGCCAGAGGCCCTGGTGAGGAGG - Intergenic
1197769695 X:130082265-130082287 CTCCAGAGAGCCTGGAGACTGGG + Intronic
1198636051 X:138701664-138701686 CCCCAGAGGGCCTGTTTATTTGG - Intronic
1200110230 X:153737200-153737222 CTCCTGAGGGCGTGACGATGGGG - Exonic
1200183032 X:154162915-154162937 TGCCAGAGGGCCAGGAGATGGGG - Intergenic
1200188686 X:154200029-154200051 TGCCAGAGGGCCAGGAGATGGGG - Intergenic
1200194335 X:154237170-154237192 TGCCAGAGGGCCAGGAGATGGGG - Intergenic
1200200091 X:154274973-154274995 TGCCAGAGGGCCAGGAGATGGGG - Intronic
1201766798 Y:17579997-17580019 GTGCGGAGGACCTGGTGATGTGG - Intergenic
1201834755 Y:18325988-18326010 GTGCGGAGGACCTGGTGATGTGG + Intergenic