ID: 1057233111

View in Genome Browser
Species Human (GRCh38)
Location 9:93337044-93337066
Sequence TGTCAGGCTGAGAACTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057233106_1057233111 14 Left 1057233106 9:93337007-93337029 CCCTCTCAGAACACTTAGGTGCT 0: 2
1: 0
2: 1
3: 10
4: 131
Right 1057233111 9:93337044-93337066 TGTCAGGCTGAGAACTGGACTGG No data
1057233104_1057233111 29 Left 1057233104 9:93336992-93337014 CCTAGGAGCTGCACTCCCTCTCA 0: 1
1: 0
2: 1
3: 22
4: 208
Right 1057233111 9:93337044-93337066 TGTCAGGCTGAGAACTGGACTGG No data
1057233107_1057233111 13 Left 1057233107 9:93337008-93337030 CCTCTCAGAACACTTAGGTGCTG 0: 2
1: 0
2: 0
3: 10
4: 102
Right 1057233111 9:93337044-93337066 TGTCAGGCTGAGAACTGGACTGG No data
1057233103_1057233111 30 Left 1057233103 9:93336991-93337013 CCCTAGGAGCTGCACTCCCTCTC 0: 1
1: 0
2: 0
3: 14
4: 178
Right 1057233111 9:93337044-93337066 TGTCAGGCTGAGAACTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057233111 Original CRISPR TGTCAGGCTGAGAACTGGAC TGG Intronic
No off target data available for this crispr