ID: 1057233175

View in Genome Browser
Species Human (GRCh38)
Location 9:93337542-93337564
Sequence GCTTCTCCTTTGCTTTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057233173_1057233175 -3 Left 1057233173 9:93337522-93337544 CCTTGTTAAGAAAGTGCCTTGCT 0: 1
1: 26
2: 385
3: 539
4: 610
Right 1057233175 9:93337542-93337564 GCTTCTCCTTTGCTTTTGCCAGG No data
1057233172_1057233175 0 Left 1057233172 9:93337519-93337541 CCACCTTGTTAAGAAAGTGCCTT 0: 2
1: 9
2: 247
3: 537
4: 866
Right 1057233175 9:93337542-93337564 GCTTCTCCTTTGCTTTTGCCAGG No data
1057233169_1057233175 27 Left 1057233169 9:93337492-93337514 CCCTTTGCTCGGCACTTCTCCTT 0: 65
1: 500
2: 653
3: 747
4: 832
Right 1057233175 9:93337542-93337564 GCTTCTCCTTTGCTTTTGCCAGG No data
1057233168_1057233175 28 Left 1057233168 9:93337491-93337513 CCCCTTTGCTCGGCACTTCTCCT 0: 31
1: 286
2: 758
3: 1012
4: 1112
Right 1057233175 9:93337542-93337564 GCTTCTCCTTTGCTTTTGCCAGG No data
1057233171_1057233175 8 Left 1057233171 9:93337511-93337533 CCTTTGTGCCACCTTGTTAAGAA 0: 1
1: 2
2: 23
3: 260
4: 988
Right 1057233175 9:93337542-93337564 GCTTCTCCTTTGCTTTTGCCAGG No data
1057233170_1057233175 26 Left 1057233170 9:93337493-93337515 CCTTTGCTCGGCACTTCTCCTTT 0: 2
1: 37
2: 215
3: 369
4: 752
Right 1057233175 9:93337542-93337564 GCTTCTCCTTTGCTTTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057233175 Original CRISPR GCTTCTCCTTTGCTTTTGCC AGG Intronic
No off target data available for this crispr