ID: 1057236678

View in Genome Browser
Species Human (GRCh38)
Location 9:93366751-93366773
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 2, 1: 0, 2: 3, 3: 20, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057236673_1057236678 17 Left 1057236673 9:93366711-93366733 CCATGGAGAGGAGGAGAGGCAGT No data
Right 1057236678 9:93366751-93366773 CAGCTCACAGAACCTTGAGCTGG 0: 2
1: 0
2: 3
3: 20
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057236678 Original CRISPR CAGCTCACAGAACCTTGAGC TGG Intergenic
900410762 1:2511502-2511524 CAGCTGACAGAGCCTTGAGCAGG + Intronic
900483124 1:2908972-2908994 CAGGTCAGAGAACCTGGGGCAGG + Intergenic
900774102 1:4568915-4568937 GAGCTCACAGAGCCTTCCGCAGG + Intergenic
901196731 1:7444470-7444492 CAGCAAACAGAACCTTGGGCTGG - Intronic
903849573 1:26297792-26297814 CAGGTCACAGGACCTAGATCAGG + Intronic
905061763 1:35145806-35145828 CAGGTTACAGAACCTTAAGAAGG - Intergenic
906016000 1:42580221-42580243 CAGCTCCAAGGAACTTGAGCTGG + Intronic
908077670 1:60538785-60538807 GACCTCAGAGGACCTTGAGCAGG + Intergenic
909501623 1:76340803-76340825 CACCTCTCAGAATCTAGAGCTGG + Intronic
911266115 1:95745118-95745140 AACCTCAAAGAACCCTGAGCAGG - Intergenic
914919897 1:151839556-151839578 CAGGCCAGAGAAGCTTGAGCCGG - Intronic
917835149 1:178935865-178935887 CAGCCCACACAACGTTGACCAGG + Intergenic
920025204 1:202988927-202988949 CATCTCACAGAACCTAGCCCAGG - Intergenic
920787132 1:209051994-209052016 CAGCACACAGAGTCTTCAGCAGG + Intergenic
921080021 1:211731793-211731815 CAGTAAACAGAATCTTGAGCTGG - Intergenic
921504963 1:215956601-215956623 CAGCCCACAGAGCCATGAGAGGG - Intronic
923979216 1:239301982-239302004 CAGCCTGCAGAACCGTGAGCAGG + Intergenic
1063868390 10:10391779-10391801 AAACTCAAAGAACCTGGAGCTGG + Intergenic
1065166581 10:22985394-22985416 CAGCTCTCAGAAGCTTGATAAGG - Intronic
1065561669 10:26970116-26970138 CAGCTAACAGAAACTAGGGCCGG - Intergenic
1067330258 10:45309143-45309165 CAGCTCACAGAATCTGGGTCAGG + Intronic
1071054171 10:81490142-81490164 CAGGTCACACAGCCATGAGCTGG - Intergenic
1075995084 10:126870653-126870675 CATCACACAGGTCCTTGAGCAGG - Intergenic
1077905837 11:6532869-6532891 CAGCTGACTGGACATTGAGCAGG + Intronic
1078413602 11:11147611-11147633 CGGGTCCCAGAACCTGGAGCAGG - Intergenic
1080794792 11:35553380-35553402 CAGCCTGCAGAACCATGAGCCGG + Intergenic
1081456352 11:43227051-43227073 TAGCTCATGGGACCTTGAGCAGG - Intergenic
1081912216 11:46707052-46707074 CAGCCCACAAAACCTCGCGCTGG + Intergenic
1083901233 11:65644506-65644528 GAGTTCAGAGCACCTTGAGCTGG + Intronic
1085475161 11:76784415-76784437 CGGCTCACAGGACCCGGAGCTGG + Intronic
1085508471 11:77073426-77073448 CTGCTCACAGCACCCTGGGCGGG + Intronic
1087164571 11:94988738-94988760 TAGCTCACAGAATCTTCAGCAGG - Intronic
1087789419 11:102391254-102391276 CAGCTCCCACACCCCTGAGCTGG + Intergenic
1087942064 11:104109894-104109916 CACCTCTCATCACCTTGAGCAGG + Intronic
1089019838 11:115201749-115201771 CAGGTCACAAAAAATTGAGCTGG + Intronic
1091106521 11:132924763-132924785 ATGCTCAGAGAACATTGAGCAGG - Intronic
1091934068 12:4421206-4421228 GAGCTCACAGACCCTTGTGGAGG - Intergenic
1091998063 12:5010736-5010758 CAACCTACAGAACCTGGAGCGGG + Intergenic
1095516522 12:43012316-43012338 TAGCTCATAGAACCTTCAGGAGG - Intergenic
1096436824 12:51598359-51598381 CAGGGCACAGAACCTTGGGAAGG + Intronic
1103576733 12:121883014-121883036 CACCTCACCCAGCCTTGAGCTGG + Intergenic
1104584608 12:130038036-130038058 CAGTTCACAGATCCTGAAGCAGG - Intergenic
1105281187 13:18963622-18963644 CAGCTCAGAGAGCCTTGTGTGGG - Intergenic
1105290389 13:19049638-19049660 CAGCTCAGAGAGCCTTGTGTGGG - Intergenic
1105783943 13:23729132-23729154 CAGCTCACACAGCCTTGGGCAGG - Intergenic
1107315329 13:39125469-39125491 CAGAGCAGAGAACATTGAGCTGG + Intergenic
1108317210 13:49248338-49248360 CTTCTCACAGGACCTAGAGCTGG + Intronic
1108667258 13:52645136-52645158 CAGCTCACTGAACCTCGACCTGG + Intergenic
1110973640 13:81800931-81800953 CATCTCACAGCCCCTTAAGCTGG - Intergenic
1114763534 14:25344792-25344814 CAGCTGGCAGAACCCTGAGGTGG + Intergenic
1115155906 14:30338722-30338744 CAGCTCACATAATCTTTACCAGG - Intergenic
1116970688 14:51061784-51061806 AAGCTTACAGAACCCTGAGTAGG - Intronic
1117237182 14:53790504-53790526 CAGCTCAGAGAAACTTAAGCTGG - Intergenic
1118313037 14:64706840-64706862 CAGCTCCCAGAACCTTGTGAAGG + Intronic
1121265152 14:92597076-92597098 CATCTCACAGAACCATGGGGAGG + Intronic
1122318999 14:100842084-100842106 CAGCTCACAAAACCTCCGGCTGG + Intergenic
1122531661 14:102432052-102432074 CAGCTCAGAGGACTTTGACCAGG + Exonic
1122859275 14:104575265-104575287 CAGAGCCCAGAACCTTCAGCAGG + Intronic
1122901040 14:104782468-104782490 CAGCTCACAGAACCTGGGGCTGG - Intronic
1123832376 15:24154056-24154078 CAGCTTATAAAACCTTGAGCAGG - Intergenic
1124174857 15:27414987-27415009 AAGCTCAGAGGACCTTAAGCAGG - Intronic
1124209585 15:27752162-27752184 CAGCACACAGACCCTTCATCTGG + Intergenic
1125185379 15:36924026-36924048 CAGGTCACAGAACCTTAAAAAGG - Intronic
1126452444 15:48823518-48823540 CAGCTAACAGAATCTGGAGAGGG - Intergenic
1128308270 15:66614190-66614212 CAGCTCCCTGCACCTGGAGCTGG + Intronic
1128557350 15:68640944-68640966 CTTCACACAGAACCCTGAGCTGG - Intronic
1129660978 15:77552744-77552766 CAGTTCAAAGAACCCTGATCTGG + Intergenic
1132492861 16:243399-243421 CAGGTCAGAGAGACTTGAGCAGG - Intronic
1133019923 16:2962899-2962921 CGGCTCACTGAGCCCTGAGCTGG - Intergenic
1133954228 16:10426200-10426222 CAACTCACAGATCTTTGAGATGG - Intronic
1135910845 16:26559322-26559344 CAGATCAGACTACCTTGAGCAGG - Intergenic
1141712947 16:85710502-85710524 CATCTCACAGAACCATGAGTCGG + Intronic
1143054841 17:4155137-4155159 CTGCTGACACAACCTTGACCCGG + Intronic
1143866774 17:9929296-9929318 CAGACCACAGAACCTGGGGCTGG - Intronic
1145992674 17:29088501-29088523 CAGCTCACAGTCCATGGAGCAGG - Intronic
1147165488 17:38591006-38591028 CAGATCACAGAAACTTAGGCTGG + Intronic
1148632374 17:49121202-49121224 CTGCTCCCAGAGCCTTGCGCAGG - Intergenic
1150550786 17:66207900-66207922 CAGCTGATAGAACCTTGAAATGG + Intergenic
1151156235 17:72124370-72124392 CAGCTCACTCGACCTTGAGGAGG + Exonic
1151960923 17:77405272-77405294 GAGCTCACCGAGCCGTGAGCAGG + Intronic
1153603697 18:6809469-6809491 CAACCCACAGAACCATGGGCTGG - Intronic
1156737306 18:40275953-40275975 CAGCTCACATATCCTTCAGCAGG + Intergenic
1157388645 18:47282148-47282170 GAGCTCACATAACCAAGAGCTGG + Intergenic
1157490173 18:48117701-48117723 CATCTCACAGAACATTGCTCTGG + Intronic
1158071414 18:53475415-53475437 CAGCTCACAGACCCTGGGCCTGG - Intronic
1158415747 18:57248353-57248375 CAGCTGCCAGAAACTTTAGCAGG + Intergenic
1159879538 18:73845407-73845429 CAGCTCACAGTAACTTTACCTGG + Intergenic
1164572836 19:29386545-29386567 CAGGTCCCACAACCTTGAGTGGG - Intergenic
1165711524 19:38014438-38014460 CTGCCCCCAGAACCTTCAGCTGG - Intronic
1168471044 19:56641161-56641183 CAGGTCACAGAGTCTTGAGAGGG - Intergenic
925291046 2:2748917-2748939 CAGCTCTCAGAACCAGGGGCAGG + Intergenic
926088281 2:10033512-10033534 CATCTCACAGACCCTTGATGTGG + Intergenic
930030481 2:47055589-47055611 CAGCTCCCAGAGCCGTGACCTGG - Intronic
931119601 2:59201363-59201385 CAGTTCAGAGACCCTTGTGCTGG + Intergenic
931177483 2:59868582-59868604 CTGCTCCCAGAACCCTGTGCAGG + Intergenic
931688504 2:64815389-64815411 AAGCTCACAGAACTTTGCTCGGG - Intergenic
932117231 2:69063184-69063206 AAGCTCAAAGAACCTCAAGCAGG + Intronic
942409819 2:175697302-175697324 CAGCTCAGAGAACAGTGGGCAGG - Intergenic
945664354 2:212722159-212722181 CAGCTAACAGAACCTGTAACTGG + Intergenic
947576062 2:231275616-231275638 CAGCTCAGAGTGCCTAGAGCTGG + Intronic
948170135 2:235894810-235894832 CAGGTCAAAGAACACTGAGCTGG + Intronic
1172755391 20:37280198-37280220 CAGCCCACAGAATCCTGAGTTGG + Intergenic
1173334638 20:42102475-42102497 CAGCTCACACACCCTATAGCAGG - Intronic
1173594037 20:44247502-44247524 CAGCTCGCAGAAGGTAGAGCCGG + Exonic
1173842185 20:46165058-46165080 CAGCTCACAGACCCCTCATCAGG - Intergenic
1174385679 20:50187447-50187469 CTGCCCTCAGAACCTAGAGCCGG - Intergenic
1175503246 20:59465051-59465073 CAGCCCACAGAACTATGAGCCGG + Intergenic
1175806549 20:61832249-61832271 CAGCTCACAAGCCCTTGAGCTGG - Intronic
1178822407 21:35987485-35987507 CATCTCACACAAACTGGAGCTGG + Intronic
1179791233 21:43757132-43757154 CAGCTCCCAGGCCCTTGGGCAGG + Exonic
1180833529 22:18918611-18918633 CAGCTCAGGGCACCTGGAGCAGG + Intronic
1181442018 22:22941635-22941657 CAGCCCACAGACCCCTGACCTGG - Intergenic
1182071451 22:27466613-27466635 CAGTTTACATAACCATGAGCAGG + Intergenic
1183766268 22:39878452-39878474 AAGCTCAGAGAACATTAAGCAGG + Intronic
1184361554 22:44022220-44022242 CAGCTCATGGAACTTTGTGCTGG + Intronic
1184728208 22:46358219-46358241 CAGGTCACAGAAACATGAGTAGG + Intergenic
1185210408 22:49567694-49567716 CAGCCCACAGCACCCTTAGCTGG + Intronic
1203283614 22_KI270734v1_random:143909-143931 CAGCTCAGGGCACCTGGAGCAGG + Intergenic
950522963 3:13507255-13507277 CAGCTCACAGGTTCTGGAGCTGG - Intergenic
952167535 3:30767083-30767105 CACCTCACAGAACTTTGATGGGG - Intronic
954922296 3:54202331-54202353 GAGCTCACAGAATCCTGAACAGG - Intronic
955017763 3:55088473-55088495 CAGCCCAGAGACCCTTGATCAGG - Intergenic
957255157 3:77826694-77826716 CAGCTCACAGAGCCTTTTGGTGG + Intergenic
957318719 3:78601887-78601909 GAGCTCACAGAAGATTGACCAGG - Intronic
959109499 3:102105195-102105217 CAGCTCACAGAAACTGGAGCAGG - Intronic
961024978 3:123547472-123547494 CAGCTCACAGGTCCCAGAGCAGG + Intronic
961353918 3:126321968-126321990 CAGCTGCCAGAACCTGGAGGTGG - Intergenic
961807706 3:129501135-129501157 CAGCACACCGGACCTTGAGGGGG + Intronic
963560594 3:146860122-146860144 CACCTCAGAGAACCTTGAGATGG + Intergenic
968089609 3:195892081-195892103 CTGCACAAAGAACCTTGGGCTGG - Intronic
970452010 4:16178250-16178272 CATCTCACAGCAGCTCGAGCAGG - Intronic
971129862 4:23795825-23795847 AAGCTCAGAGAAGCTTGCGCAGG - Exonic
981741684 4:148008738-148008760 CACCTCACAGAACCCTGAAAAGG - Intronic
982069710 4:151684640-151684662 CAGTTCAAAGAACGTTTAGCTGG - Intronic
983662632 4:170145127-170145149 CACCTCATAGGACCTTTAGCTGG - Intergenic
985947076 5:3194161-3194183 CAGCTCCTAAAAGCTTGAGCAGG - Intergenic
986295131 5:6431334-6431356 CAGATCCCAGCACCTTGTGCTGG + Intergenic
986779139 5:11048135-11048157 GAGCTCCCAGAACCTGGAACTGG + Intronic
987605743 5:20133799-20133821 CAGCTCAGAGAACACTAAGCAGG - Intronic
990653652 5:57930587-57930609 CAGCCCACAGAAGTCTGAGCTGG - Intergenic
991439596 5:66633310-66633332 CAGCTCATACAACCTGGAGGTGG - Intronic
992592745 5:78312290-78312312 AAGCTCAGAGAACACTGAGCAGG + Intergenic
997695601 5:135858410-135858432 CAGATCACAGAAACTTGTGGGGG - Intronic
997697730 5:135874587-135874609 CAGTTCACAGGGCCTGGAGCTGG - Intronic
998164270 5:139833782-139833804 CAGCAGACAGTACCTTCAGCAGG - Exonic
998546071 5:143028998-143029020 CAGCTCTCAGAAGCTTCAGTGGG - Intronic
998958698 5:147462976-147462998 AACCTGACAGAACCTTGTGCTGG - Intronic
999288300 5:150407179-150407201 CACCTCCCAGAACCTGCAGCTGG - Exonic
1000005176 5:157176443-157176465 CAGTTGTCAGAACCTTCAGCTGG + Intronic
1001086385 5:168702842-168702864 CAGGACAAAGAACCTTGAGAAGG + Intronic
1001663036 5:173410911-173410933 CCGTTCACTGAACCCTGAGCTGG - Intergenic
1001992658 5:176130902-176130924 CAGCTCACAGAACATTCTCCAGG - Intronic
1002065985 5:176651888-176651910 CAGCACTCACAAACTTGAGCAGG - Exonic
1002224222 5:177707244-177707266 CAGCTCACAGAACATTCTCCAGG + Intergenic
1002773494 6:308951-308973 GCGCTCACAGAACCTGGAGGAGG - Intronic
1003453330 6:6257759-6257781 CAGCTCACACCAGCTTGAGAAGG + Intronic
1006748023 6:36358608-36358630 CAGCTCACTGACCCTTGTGGGGG + Intronic
1007969326 6:46034802-46034824 CAGCTGACAGAGGCTAGAGCAGG + Intronic
1008815160 6:55556410-55556432 CAACTCACAGAACATTGTGCTGG - Intronic
1010521044 6:76837822-76837844 CAACTCCCAGAAGCTTGAGATGG - Intergenic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1013933223 6:115560865-115560887 ATGTTCACAGAACCTTCAGCAGG - Intergenic
1014673761 6:124339474-124339496 CAGCTAACAGAACCTGGAAGAGG - Intronic
1016056966 6:139588183-139588205 CAGCTCACATTACCTTCAGCTGG - Intergenic
1017675942 6:156813914-156813936 CAGCGCACACATCCTTGAGATGG - Intronic
1018441346 6:163816333-163816355 CAGCTCACAGATGATGGAGCTGG - Intergenic
1018995935 6:168710405-168710427 CAGCCCACAGACCATTCAGCCGG - Intergenic
1019062160 6:169264333-169264355 TAGCACACAGAACCCTGAGCAGG + Intergenic
1019062180 6:169264485-169264507 TAGCACACAGCACCCTGAGCAGG + Intergenic
1019146890 6:169981388-169981410 CTGCTCACTGAACCTGGAGGGGG + Intergenic
1019146907 6:169981460-169981482 AAGCTCACTGAACCTGGAGGGGG + Intergenic
1019335631 7:481260-481282 CAGATCTCAGATCCGTGAGCTGG + Intergenic
1022467943 7:30663828-30663850 CAGCTCCCCGGACCTTGAGCTGG - Intronic
1023119212 7:36892494-36892516 CTGCCCCCAGCACCTTGAGCAGG + Intronic
1034523292 7:151637817-151637839 CAGCACACAGAACTTGAAGCTGG + Intronic
1038063308 8:23936322-23936344 CAGCTCTGAGAACTTTGCGCGGG + Intergenic
1041443421 8:57924161-57924183 CACCTAACAGCACCTTGAGGAGG - Intergenic
1042571216 8:70167186-70167208 CCACTCACAGAATTTTGAGCAGG - Intronic
1044552971 8:93532599-93532621 GAGCACACAGAACCTAGAGAAGG - Intergenic
1045268709 8:100643600-100643622 CAGCACCATGAACCTTGAGCGGG + Intronic
1045318649 8:101064662-101064684 GAGCTACCAGAACCTTGAGGAGG + Intergenic
1048734696 8:137486310-137486332 CGGCCTACAGAACCATGAGCAGG - Intergenic
1049656973 8:143803321-143803343 CGGCTCACAACACCTTGGGCTGG + Intronic
1049846745 8:144806177-144806199 CTGCAGAAAGAACCTTGAGCTGG + Intronic
1052113636 9:24621151-24621173 AAGCTAACTGAACCTTGAGTTGG + Intergenic
1056577386 9:87866922-87866944 CAGCTCACAAAGCCTCCAGCAGG + Intergenic
1057231418 9:93323872-93323894 CAGCTCACAGAACCTTGAGCTGG - Intronic
1057236678 9:93366751-93366773 CAGCTCACAGAACCTTGAGCTGG + Intergenic
1058390651 9:104491366-104491388 CAGCCCAGAGAACTTTGAGCTGG - Intergenic
1059170831 9:112123170-112123192 CAGCCTGCAGAACCATGAGCTGG - Intronic
1059909553 9:119027216-119027238 CAGCTCATAGAAACTGGGGCAGG + Intergenic
1060108529 9:120890230-120890252 CAGCTCACAAAACCTGAATCAGG - Intronic
1061840577 9:133356537-133356559 CCGCTCGCAGAACCTGGAGCCGG - Exonic
1187209367 X:17213921-17213943 CCCCTCACAGAACTTTTAGCTGG + Intergenic
1193635882 X:83948634-83948656 CAGCTCACATGCCCTTGATCTGG + Intergenic
1195260173 X:103124149-103124171 CTGCTTACAGGACCTTGTGCTGG - Intergenic
1196058047 X:111377336-111377358 CAGCACAAAGAACCTTCAGCTGG - Intronic
1197795700 X:130295971-130295993 CAGCTCACAGAATCTTGTGAAGG + Intergenic
1198376046 X:136041238-136041260 CAACACGCAGAACCTTGAGAGGG + Intronic
1199431637 X:147767761-147767783 CAGCTCATATATCCTTGAACAGG - Intergenic