ID: 1057238288

View in Genome Browser
Species Human (GRCh38)
Location 9:93384192-93384214
Sequence TATTATAGGCAGTAATTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057238288_1057238292 18 Left 1057238288 9:93384192-93384214 CCATCTAATTACTGCCTATAATA No data
Right 1057238292 9:93384233-93384255 TAAAAGTAAAAGAAAGTTACAGG No data
1057238288_1057238291 -6 Left 1057238288 9:93384192-93384214 CCATCTAATTACTGCCTATAATA No data
Right 1057238291 9:93384209-93384231 ATAATAAATTAAAAAGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057238288 Original CRISPR TATTATAGGCAGTAATTAGA TGG (reversed) Intergenic
No off target data available for this crispr