ID: 1057240228

View in Genome Browser
Species Human (GRCh38)
Location 9:93401122-93401144
Sequence ATTGAAGAGGTGAGAACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057240228_1057240233 18 Left 1057240228 9:93401122-93401144 CCTTCAGTTCTCACCTCTTCAAT No data
Right 1057240233 9:93401163-93401185 AAATCCGCCTTTGCAGAGGGTGG No data
1057240228_1057240235 22 Left 1057240228 9:93401122-93401144 CCTTCAGTTCTCACCTCTTCAAT No data
Right 1057240235 9:93401167-93401189 CCGCCTTTGCAGAGGGTGGCAGG No data
1057240228_1057240231 14 Left 1057240228 9:93401122-93401144 CCTTCAGTTCTCACCTCTTCAAT No data
Right 1057240231 9:93401159-93401181 TCAGAAATCCGCCTTTGCAGAGG No data
1057240228_1057240232 15 Left 1057240228 9:93401122-93401144 CCTTCAGTTCTCACCTCTTCAAT No data
Right 1057240232 9:93401160-93401182 CAGAAATCCGCCTTTGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057240228 Original CRISPR ATTGAAGAGGTGAGAACTGA AGG (reversed) Intergenic
No off target data available for this crispr