ID: 1057240229

View in Genome Browser
Species Human (GRCh38)
Location 9:93401135-93401157
Sequence GAGGACTATGAGAATTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057240229_1057240233 5 Left 1057240229 9:93401135-93401157 CCTCTTCAATTCTCATAGTCCTC No data
Right 1057240233 9:93401163-93401185 AAATCCGCCTTTGCAGAGGGTGG No data
1057240229_1057240237 20 Left 1057240229 9:93401135-93401157 CCTCTTCAATTCTCATAGTCCTC No data
Right 1057240237 9:93401178-93401200 GAGGGTGGCAGGTCCTTTTTTGG No data
1057240229_1057240238 21 Left 1057240229 9:93401135-93401157 CCTCTTCAATTCTCATAGTCCTC No data
Right 1057240238 9:93401179-93401201 AGGGTGGCAGGTCCTTTTTTGGG No data
1057240229_1057240235 9 Left 1057240229 9:93401135-93401157 CCTCTTCAATTCTCATAGTCCTC No data
Right 1057240235 9:93401167-93401189 CCGCCTTTGCAGAGGGTGGCAGG No data
1057240229_1057240232 2 Left 1057240229 9:93401135-93401157 CCTCTTCAATTCTCATAGTCCTC No data
Right 1057240232 9:93401160-93401182 CAGAAATCCGCCTTTGCAGAGGG No data
1057240229_1057240231 1 Left 1057240229 9:93401135-93401157 CCTCTTCAATTCTCATAGTCCTC No data
Right 1057240231 9:93401159-93401181 TCAGAAATCCGCCTTTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057240229 Original CRISPR GAGGACTATGAGAATTGAAG AGG (reversed) Intergenic
No off target data available for this crispr