ID: 1057240230

View in Genome Browser
Species Human (GRCh38)
Location 9:93401154-93401176
Sequence GCAAAGGCGGATTTCTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057240230_1057240235 -10 Left 1057240230 9:93401154-93401176 CCTCTTCAGAAATCCGCCTTTGC No data
Right 1057240235 9:93401167-93401189 CCGCCTTTGCAGAGGGTGGCAGG No data
1057240230_1057240238 2 Left 1057240230 9:93401154-93401176 CCTCTTCAGAAATCCGCCTTTGC No data
Right 1057240238 9:93401179-93401201 AGGGTGGCAGGTCCTTTTTTGGG No data
1057240230_1057240237 1 Left 1057240230 9:93401154-93401176 CCTCTTCAGAAATCCGCCTTTGC No data
Right 1057240237 9:93401178-93401200 GAGGGTGGCAGGTCCTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057240230 Original CRISPR GCAAAGGCGGATTTCTGAAG AGG (reversed) Intergenic
No off target data available for this crispr