ID: 1057240235

View in Genome Browser
Species Human (GRCh38)
Location 9:93401167-93401189
Sequence CCGCCTTTGCAGAGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057240230_1057240235 -10 Left 1057240230 9:93401154-93401176 CCTCTTCAGAAATCCGCCTTTGC No data
Right 1057240235 9:93401167-93401189 CCGCCTTTGCAGAGGGTGGCAGG No data
1057240229_1057240235 9 Left 1057240229 9:93401135-93401157 CCTCTTCAATTCTCATAGTCCTC No data
Right 1057240235 9:93401167-93401189 CCGCCTTTGCAGAGGGTGGCAGG No data
1057240228_1057240235 22 Left 1057240228 9:93401122-93401144 CCTTCAGTTCTCACCTCTTCAAT No data
Right 1057240235 9:93401167-93401189 CCGCCTTTGCAGAGGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057240235 Original CRISPR CCGCCTTTGCAGAGGGTGGC AGG Intergenic
No off target data available for this crispr