ID: 1057242654

View in Genome Browser
Species Human (GRCh38)
Location 9:93425540-93425562
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057242654_1057242656 7 Left 1057242654 9:93425540-93425562 CCAGCACCATATTGTTTTGACTA No data
Right 1057242656 9:93425570-93425592 CTTGTAATAAGCTTCAAAATCGG No data
1057242654_1057242657 8 Left 1057242654 9:93425540-93425562 CCAGCACCATATTGTTTTGACTA No data
Right 1057242657 9:93425571-93425593 TTGTAATAAGCTTCAAAATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057242654 Original CRISPR TAGTCAAAACAATATGGTGC TGG (reversed) Intergenic
No off target data available for this crispr