ID: 1057242656

View in Genome Browser
Species Human (GRCh38)
Location 9:93425570-93425592
Sequence CTTGTAATAAGCTTCAAAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057242652_1057242656 25 Left 1057242652 9:93425522-93425544 CCATATGTCTGCCTCATGCCAGC No data
Right 1057242656 9:93425570-93425592 CTTGTAATAAGCTTCAAAATCGG No data
1057242654_1057242656 7 Left 1057242654 9:93425540-93425562 CCAGCACCATATTGTTTTGACTA No data
Right 1057242656 9:93425570-93425592 CTTGTAATAAGCTTCAAAATCGG No data
1057242653_1057242656 14 Left 1057242653 9:93425533-93425555 CCTCATGCCAGCACCATATTGTT No data
Right 1057242656 9:93425570-93425592 CTTGTAATAAGCTTCAAAATCGG No data
1057242655_1057242656 1 Left 1057242655 9:93425546-93425568 CCATATTGTTTTGACTACTAAAG No data
Right 1057242656 9:93425570-93425592 CTTGTAATAAGCTTCAAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057242656 Original CRISPR CTTGTAATAAGCTTCAAAAT CGG Intergenic
No off target data available for this crispr