ID: 1057242782

View in Genome Browser
Species Human (GRCh38)
Location 9:93426873-93426895
Sequence GTGCAGGAGGAGAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057242775_1057242782 19 Left 1057242775 9:93426831-93426853 CCTATTAGGTTTGCCAACGGGCG No data
Right 1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG No data
1057242772_1057242782 29 Left 1057242772 9:93426821-93426843 CCTCTGTTTTCCTATTAGGTTTG No data
Right 1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG No data
1057242777_1057242782 6 Left 1057242777 9:93426844-93426866 CCAACGGGCGGCACTAGCACAAG No data
Right 1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057242782 Original CRISPR GTGCAGGAGGAGAGTGAGGA TGG Intergenic
No off target data available for this crispr