ID: 1057243397

View in Genome Browser
Species Human (GRCh38)
Location 9:93433013-93433035
Sequence TGCCCAGCATAACGATGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057243397_1057243401 27 Left 1057243397 9:93433013-93433035 CCTCTTCATCGTTATGCTGGGCA No data
Right 1057243401 9:93433063-93433085 TCATACACTGCAACTCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057243397 Original CRISPR TGCCCAGCATAACGATGAAG AGG (reversed) Intergenic
No off target data available for this crispr