ID: 1057245619

View in Genome Browser
Species Human (GRCh38)
Location 9:93451906-93451928
Sequence CGCCGCCGCCATGGGCGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 1, 2: 2, 3: 8, 4: 107}

Found 21 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057245604_1057245619 4 Left 1057245604 9:93451879-93451901 CCCCGCCCGCACCCGCGCCCGCG 0: 1
1: 8
2: 30
3: 155
4: 1088
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245591_1057245619 28 Left 1057245591 9:93451855-93451877 CCCACCACCCCCGGCCCCGCCGC 0: 1
1: 1
2: 16
3: 146
4: 1288
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245595_1057245619 20 Left 1057245595 9:93451863-93451885 CCCCGGCCCCGCCGCCCCCCGCC 0: 1
1: 10
2: 91
3: 633
4: 3321
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245607_1057245619 -1 Left 1057245607 9:93451884-93451906 CCCGCACCCGCGCCCGCGCCCCC 0: 1
1: 4
2: 44
3: 238
4: 1618
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245590_1057245619 29 Left 1057245590 9:93451854-93451876 CCCCACCACCCCCGGCCCCGCCG 0: 1
1: 0
2: 17
3: 181
4: 1360
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245594_1057245619 21 Left 1057245594 9:93451862-93451884 CCCCCGGCCCCGCCGCCCCCCGC 0: 1
1: 4
2: 69
3: 581
4: 3252
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245602_1057245619 6 Left 1057245602 9:93451877-93451899 CCCCCCGCCCGCACCCGCGCCCG 0: 1
1: 2
2: 22
3: 165
4: 1192
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245598_1057245619 14 Left 1057245598 9:93451869-93451891 CCCCGCCGCCCCCCGCCCGCACC 0: 1
1: 2
2: 33
3: 334
4: 2219
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245605_1057245619 3 Left 1057245605 9:93451880-93451902 CCCGCCCGCACCCGCGCCCGCGC 0: 1
1: 3
2: 20
3: 119
4: 923
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245606_1057245619 2 Left 1057245606 9:93451881-93451903 CCGCCCGCACCCGCGCCCGCGCC 0: 1
1: 4
2: 32
3: 199
4: 1326
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245609_1057245619 -7 Left 1057245609 9:93451890-93451912 CCCGCGCCCGCGCCCCCGCCGCC 0: 1
1: 11
2: 84
3: 639
4: 3721
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245601_1057245619 9 Left 1057245601 9:93451874-93451896 CCGCCCCCCGCCCGCACCCGCGC 0: 1
1: 2
2: 27
3: 255
4: 2138
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245600_1057245619 12 Left 1057245600 9:93451871-93451893 CCGCCGCCCCCCGCCCGCACCCG 0: 1
1: 3
2: 29
3: 386
4: 2513
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245592_1057245619 27 Left 1057245592 9:93451856-93451878 CCACCACCCCCGGCCCCGCCGCC 0: 1
1: 7
2: 70
3: 883
4: 5450
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245603_1057245619 5 Left 1057245603 9:93451878-93451900 CCCCCGCCCGCACCCGCGCCCGC 0: 1
1: 4
2: 38
3: 250
4: 1667
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245608_1057245619 -2 Left 1057245608 9:93451885-93451907 CCGCACCCGCGCCCGCGCCCCCG 0: 2
1: 3
2: 28
3: 289
4: 1403
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245596_1057245619 19 Left 1057245596 9:93451864-93451886 CCCGGCCCCGCCGCCCCCCGCCC 0: 1
1: 5
2: 89
3: 895
4: 4031
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245597_1057245619 18 Left 1057245597 9:93451865-93451887 CCGGCCCCGCCGCCCCCCGCCCG 0: 1
1: 9
2: 82
3: 826
4: 3607
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245599_1057245619 13 Left 1057245599 9:93451870-93451892 CCCGCCGCCCCCCGCCCGCACCC 0: 1
1: 4
2: 31
3: 360
4: 2237
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245593_1057245619 24 Left 1057245593 9:93451859-93451881 CCACCCCCGGCCCCGCCGCCCCC 0: 3
1: 9
2: 138
3: 1245
4: 9617
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107
1057245610_1057245619 -8 Left 1057245610 9:93451891-93451913 CCGCGCCCGCGCCCCCGCCGCCG 0: 1
1: 12
2: 168
3: 685
4: 2653
Right 1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG 0: 1
1: 1
2: 2
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057245619 Original CRISPR CGCCGCCGCCATGGGCGTGC AGG Exonic
900492513 1:2959375-2959397 CTCCTCCTCCATGGGAGTGCTGG + Intergenic
903044144 1:20553219-20553241 AGCCGTCGCCCTTGGCGTGCAGG - Exonic
905137147 1:35808407-35808429 CGCCGCCGCCATGGAGGCGCTGG + Exonic
905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG + Intronic
906961419 1:50421483-50421505 CGCCGCCGCCGTCGCCGCGCCGG + Exonic
907883907 1:58576271-58576293 CGTCGCCGGCATGGCCGTCCTGG - Exonic
909012903 1:70354409-70354431 CGCCGCCGCCAGGGGCAAGGGGG + Exonic
916065512 1:161132650-161132672 CGCCGCCGCCGCGGCCGTGGGGG + Exonic
924482595 1:244451174-244451196 CTCCGCCGCCCTGGGCGGGGCGG + Intronic
924739979 1:246789273-246789295 GGCCGCCCCCAGGGGCCTGCTGG - Intergenic
1064408946 10:15088716-15088738 AGCCGCCACCATGGCCCTGCAGG - Exonic
1066602795 10:37125805-37125827 CGCCGCTGTCAAGGTCGTGCCGG + Intronic
1074146860 10:110724613-110724635 CCCTGCAGCCATGGGCGTGCTGG + Intronic
1075129545 10:119726234-119726256 CGCCGCCTCCCTGGGCGCGCGGG + Exonic
1075801884 10:125159482-125159504 CGCCGCCGCCACTGCCGCGCGGG - Intronic
1077404632 11:2377540-2377562 CCGCGCCGCCATGGGAGTGGAGG + Exonic
1079122460 11:17695746-17695768 GGCCGCGGCCGTGGGGGTGCTGG + Intergenic
1079353688 11:19713650-19713672 CGCCGCTGCCAGGGACGTGCTGG + Exonic
1083669476 11:64292063-64292085 CCCGGCCCCCATGGGCGTGCCGG - Intronic
1084946902 11:72643202-72643224 CGCCGCCGCGATGGGACGGCAGG - Intronic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1091750895 12:3020678-3020700 CGGCCCTGCCATGGGGGTGCCGG - Exonic
1096134587 12:49188795-49188817 CGCCGCCGCAGTGCGGGTGCAGG - Intronic
1097787779 12:63780051-63780073 CGCCGCCGCCAGGCGCCGGCCGG + Exonic
1105290911 13:19052884-19052906 CGCCGACACCATGGGGGTGTGGG - Intergenic
1111672684 13:91348767-91348789 CCCCGCCGCCATGTTCCTGCGGG + Intergenic
1119500927 14:75126909-75126931 GGCCGCCGCCATGTCGGTGCTGG - Exonic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1130335287 15:82952705-82952727 CACCGCCGCCAGGCGCGGGCGGG + Exonic
1132560270 16:590282-590304 CGGCGCGGCCATGGGCTCGCAGG + Exonic
1132869405 16:2109065-2109087 CCCCGCGGCCACGGGCGTGTAGG + Exonic
1136932637 16:34432825-34432847 TGCCACCGCCATGGGCTTCCGGG - Intergenic
1136971935 16:34978989-34979011 TGCCACCGCCATGGGCTTCCGGG + Intergenic
1137227132 16:46524195-46524217 CCCCACCCCCATGGCCGTGCTGG + Intergenic
1138527580 16:57617949-57617971 TGCCGCACCCATGGGCCTGCAGG - Intronic
1141590148 16:85063045-85063067 CGCCACAGCTATCGGCGTGCAGG + Intronic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1145970151 17:28951418-28951440 CGCCGCCGCCGTCTGCGTCCCGG + Exonic
1147686194 17:42288249-42288271 AGCCGCCGCCGAGGGCCTGCTGG + Exonic
1149270095 17:54968325-54968347 CGCTGTCGCCGTGGGCATGCTGG - Exonic
1150692350 17:67377429-67377451 CGCGGCTGCCAGGGGCGGGCGGG - Intronic
1151958931 17:77394850-77394872 CGACCCCGCCATGGGCCTGGAGG + Intronic
1154475221 18:14748437-14748459 TGCCGCTGGCAAGGGCGTGCGGG + Exonic
1160841124 19:1147484-1147506 GGCTGCGGCCATGGGGGTGCAGG - Intronic
1161063728 19:2227620-2227642 CGGCGCCGCCAGGCGTGTGCGGG - Intronic
1161532877 19:4800715-4800737 CGCCGCCCCCATGGAATTGCAGG + Exonic
1162378247 19:10317498-10317520 CGCCGAGGCCCTGGGAGTGCTGG + Exonic
1163473483 19:17511663-17511685 CGCCCTCGCCATGGCCGCGCCGG + Exonic
1164072175 19:21778208-21778230 AGCAGCAGCCATGGGCCTGCTGG + Intergenic
1165349702 19:35269092-35269114 CGCCCCCCCCATGGACATGCTGG + Exonic
1165851400 19:38852071-38852093 CGCCGGCGCGAGGGGCGTCCGGG - Intronic
1166883068 19:45940582-45940604 CGCCGCCGCCTCCGGCCTGCTGG - Exonic
1168614484 19:57826766-57826788 GGCCGCCGCCATGGGAGTGCAGG - Intronic
1168695471 19:58401566-58401588 CGCCAGCGCCATCGGAGTGCTGG - Intronic
928964862 2:36966451-36966473 TGCGGCCGCCATGGACGAGCAGG - Exonic
937073360 2:119082786-119082808 CTCTGCCACCATGGGCGTGTTGG + Intergenic
941020847 2:160407265-160407287 CGCCGCCGCCCGGGCCGGGCAGG - Intronic
946219941 2:218217461-218217483 AGCCGCCGCCATGATCCTGCTGG + Exonic
948587385 2:239027896-239027918 CGTCCCCTCCATAGGCGTGCCGG - Intergenic
948806063 2:240453807-240453829 CGTCGCCGCCCTGGGGGTCCCGG - Intronic
948888521 2:240895955-240895977 CACCTCAGCCATGGCCGTGCAGG - Exonic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1171176126 20:23051574-23051596 CGGTGCCGCCATGGGGGTGAGGG + Intergenic
1171447740 20:25216779-25216801 CCACACCGCCATGGGGGTGCAGG + Intronic
1171455807 20:25271577-25271599 CGCCCCCGCCAGGGGACTGCAGG + Intronic
1176192986 20:63822316-63822338 CGTCTCCCCCATGGGTGTGCTGG - Intronic
1176201361 20:63862197-63862219 CGCCAACGCCATGGACGTGGTGG + Exonic
1178453819 21:32728367-32728389 CGCCGCCCCCACGGGCCTGACGG + Intergenic
1179882677 21:44300096-44300118 GGCCGCCGCCATGGCCGCGGTGG + Exonic
1183787051 22:40035599-40035621 CGCCCCCGCCAAGGTCATGCAGG - Exonic
1184228242 22:43143054-43143076 CGCCGCCGCCCGCCGCGTGCTGG - Exonic
1184523171 22:45007634-45007656 CGGCGCAGCCAATGGCGTGCTGG - Intronic
1184772670 22:46607097-46607119 TGCCGGGCCCATGGGCGTGCAGG + Intronic
1184865021 22:47197451-47197473 CGCCCCCGCCCTGTGGGTGCCGG + Intergenic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
950168038 3:10816255-10816277 CTCCGCCGTCATGGCCGCGCTGG - Exonic
956765969 3:72484830-72484852 AGCCGACCCCATGGGCATGCTGG - Intergenic
956796510 3:72723050-72723072 GCCCTCGGCCATGGGCGTGCAGG - Intergenic
963778513 3:149464102-149464124 CGCAGCCGCCATGGGAGTGCAGG - Intergenic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
981782628 4:148444765-148444787 CGCCGCCGCTGGGGGCGGGCGGG - Intergenic
982484791 4:155953835-155953857 GGGCGCCGCAATGGACGTGCGGG - Exonic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
986928961 5:12794927-12794949 CGCCGCCGCCATTTTCGTGGCGG + Intergenic
996196402 5:120611952-120611974 CTCCGCCCCCATGGCTGTGCAGG - Intronic
996379020 5:122845454-122845476 CTCCCGCGCCCTGGGCGTGCCGG - Exonic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
997238959 5:132293597-132293619 CGCCGGGTCCATGGGCGGGCGGG - Intronic
997264981 5:132490266-132490288 CGCAGCCGCCAGGGGCCTGTAGG - Intronic
997980832 5:138466466-138466488 AGCCGCGGCCATGGGGGTGCTGG + Intronic
998419253 5:141968982-141969004 CAGCGCCGCCTTGGGCCTGCGGG + Intronic
1002055721 5:176597038-176597060 CGGCGCCGCCATGGAGGTGGAGG - Exonic
1002591080 5:180291990-180292012 CGCCGCCGCAGTGGGTGTGAGGG + Exonic
1005147802 6:22711472-22711494 TGCCTCCGCGATGGGCGGGCAGG + Intergenic
1005705473 6:28447276-28447298 CGCTGTCGCCGTGGGCATGCTGG + Intergenic
1007614346 6:43171580-43171602 AGCCGCCGCCATCGGCTTCCCGG - Exonic
1012624925 6:101393558-101393580 CGCGGCGGCCAGGAGCGTGCAGG + Intergenic
1013793557 6:113859927-113859949 CTCCGCGGCCGTGGGCGAGCCGG - Exonic
1014947495 6:127515673-127515695 CGCCGCCGCCATTGGGGAGGCGG + Exonic
1017438640 6:154442101-154442123 CGGCGCCGCCAAGGCCCTGCTGG - Exonic
1019500862 7:1364193-1364215 CGCTGCCTTCCTGGGCGTGCTGG + Intergenic
1020275538 7:6622402-6622424 CGCCGCCGCCGCTGCCGTGCAGG - Exonic
1022100253 7:27165155-27165177 CGCCGCCGCCACGGGCGCCTGGG + Exonic
1033200012 7:139360252-139360274 CGCCGCCGCCATGTCGGCGCAGG + Exonic
1034282969 7:149866301-149866323 CACCGTCTCCATGGGCGTTCAGG + Exonic
1034342710 7:150368666-150368688 CGCCCCCGCCAAGAGCGGGCCGG - Intronic
1038644311 8:29350197-29350219 CGCCGCCGCCATTCTCGTCCCGG + Exonic
1045112704 8:98949155-98949177 CGCCGCCGCCATCTCCGTGATGG - Exonic
1045516307 8:102863662-102863684 CGCCGCCGCCATGTTCGAGGCGG + Intronic
1049100822 8:140577872-140577894 CCCCGCCTCCAGGGGCCTGCAGG - Intronic
1049589230 8:143448589-143448611 CTCCGCCGCCATGGCTCTGCAGG + Intronic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1056992415 9:91423945-91423967 CGCGGCCGGCAGGGGCGGGCCGG + Intergenic
1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG + Exonic
1058851214 9:109013502-109013524 CGCCGCCGCCTCGGGCGGGTGGG - Exonic
1060897270 9:127225638-127225660 CGCCGAAGCCGCGGGCGTGCGGG - Intronic
1062547544 9:137070433-137070455 CGGGGCCGCCATGGCCGAGCGGG - Exonic
1187670036 X:21658140-21658162 CACCGCCGCCCCTGGCGTGCAGG - Exonic
1197776327 X:130120875-130120897 CGCCGCCGCGTTCCGCGTGCAGG - Intergenic