ID: 1057247808

View in Genome Browser
Species Human (GRCh38)
Location 9:93472511-93472533
Sequence TTGGACACACAAGGCCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057247803_1057247808 6 Left 1057247803 9:93472482-93472504 CCATGAATCTGATGGGATTTGGG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1057247808 9:93472511-93472533 TTGGACACACAAGGCCAGTTTGG No data
1057247799_1057247808 20 Left 1057247799 9:93472468-93472490 CCTGTGATTAGAATCCATGAATC 0: 1
1: 0
2: 1
3: 7
4: 135
Right 1057247808 9:93472511-93472533 TTGGACACACAAGGCCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057247808 Original CRISPR TTGGACACACAAGGCCAGTT TGG Intronic
No off target data available for this crispr