ID: 1057250491

View in Genome Browser
Species Human (GRCh38)
Location 9:93497304-93497326
Sequence AACGGCTTAGGAAAGTCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057250487_1057250491 1 Left 1057250487 9:93497280-93497302 CCAGTTCTTGAGCTTCAGAACGT 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1057250491 9:93497304-93497326 AACGGCTTAGGAAAGTCTTAGGG 0: 1
1: 0
2: 1
3: 6
4: 67
1057250486_1057250491 17 Left 1057250486 9:93497264-93497286 CCACTGAAAGGAAAATCCAGTTC 0: 1
1: 0
2: 4
3: 21
4: 209
Right 1057250491 9:93497304-93497326 AACGGCTTAGGAAAGTCTTAGGG 0: 1
1: 0
2: 1
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057250491 Original CRISPR AACGGCTTAGGAAAGTCTTA GGG Intronic
903646691 1:24900463-24900485 AAAGGCTTAGAAAAGGCGTAAGG - Exonic
905480721 1:38260174-38260196 AAAGGCTTAGGAGAGTTTTTTGG + Intergenic
906329469 1:44872744-44872766 AAAGGGTCAGGAAAGGCTTAAGG - Intronic
908783010 1:67708812-67708834 GAGGGCTCAGCAAAGTCTTAGGG + Intronic
919840025 1:201602180-201602202 AAAGACTTAGGAAAGACTTTAGG - Intergenic
1065965188 10:30765182-30765204 AATGGCTTAGGAAACACTCAGGG - Intergenic
1072681064 10:97507098-97507120 AGCTGCTGAGGAAAGTGTTATGG - Intronic
1075015513 10:118907603-118907625 AACATCTTGAGAAAGTCTTAAGG + Intergenic
1082829408 11:57604404-57604426 AACAGCTTTGCAAAGTCCTAGGG - Intronic
1086896164 11:92315139-92315161 ATCTGCTTAGGAAAATCTCAAGG - Intergenic
1090853880 11:130594918-130594940 AAAGGCTTAGGACACACTTATGG - Intergenic
1098981121 12:76956775-76956797 AAAGGCTTAGGAAAGTTCAAAGG + Intergenic
1100731609 12:97477043-97477065 AAAGACTTAGGAAAGACTTTAGG + Intergenic
1101974161 12:109340845-109340867 AATGGTTGGGGAAAGTCTTAAGG + Intergenic
1105741713 13:23331753-23331775 TAGGGCTTTGCAAAGTCTTATGG + Exonic
1116773590 14:49154224-49154246 AAAAGCTTAGTAAAGCCTTATGG - Intergenic
1118203570 14:63700445-63700467 AACGGCTAAGGAAAGAATTAAGG - Intronic
1120464395 14:84838297-84838319 AACATCTTAGGTAAGTCTTTTGG - Intergenic
1126949954 15:53869978-53870000 AAAGTCTTAGGACAGTGTTATGG - Intergenic
1130665450 15:85865467-85865489 AACTGCTTATAAAGGTCTTAGGG + Intergenic
1131298533 15:91173630-91173652 AACCACTTAGGAAAGTCATGAGG - Intronic
1135508830 16:23063497-23063519 AACACTTTAGGAAAGTCTTCAGG + Exonic
1136077507 16:27827117-27827139 AACTGCATAGTGAAGTCTTAAGG + Intronic
1149206170 17:54251150-54251172 AACTGCTTAATAAATTCTTAAGG - Intergenic
1156796332 18:41050806-41050828 TAAGGCTTAGGAAAGGCCTAGGG - Intergenic
1162272824 19:9630212-9630234 AAGGGCTTAGGAAATTCTGGGGG + Intronic
925835898 2:7946577-7946599 CATGGCATGGGAAAGTCTTAAGG + Intergenic
927533317 2:23831500-23831522 AACGGCCTAGGGAAGTATTAAGG - Intronic
929390515 2:41463840-41463862 AATGGCTGAGGAAAATTTTATGG - Intergenic
929431079 2:41887097-41887119 AACTGGTTAGAGAAGTCTTAGGG + Intergenic
929661364 2:43788576-43788598 AACAGTCTAGGAACGTCTTATGG + Intronic
930399651 2:50866953-50866975 AACAGCTTAAGAGAGTATTATGG - Intronic
930933939 2:56923854-56923876 TATGGCTTAGGAAAGACTCATGG - Intergenic
932345236 2:70991105-70991127 AAAGGCTTCGGAAAGTATTTTGG - Intronic
938190850 2:129279203-129279225 AATGGCTTAGGAAACACTTCAGG + Intergenic
939897884 2:147813828-147813850 AACTGTTTAGCAAAGTATTAAGG + Intergenic
940349785 2:152669557-152669579 ATCTGCATAGGAAAGTTTTAAGG + Intronic
941127057 2:161596536-161596558 ATCTGCTTAGGAAATTCTTTTGG + Intronic
941777641 2:169410102-169410124 AGAGGCTTAGGAAAGTGTAAGGG - Intergenic
943748683 2:191488611-191488633 AAAGGCTTAGGAAAGGCTTTGGG - Intergenic
944397490 2:199285298-199285320 AATCACTTAGGAAAGCCTTAGGG + Intronic
946441155 2:219697370-219697392 AAAGGCTTAGGAAATTCTCCCGG + Intergenic
1172975110 20:38900321-38900343 AAAGGCTTAGGGAGGTCTTCTGG + Intronic
950710204 3:14808647-14808669 AAGGGCTTAGCAAAGCCTTGAGG + Intergenic
952653159 3:35750676-35750698 CAGGGCTTTAGAAAGTCTTATGG - Intronic
960917721 3:122713989-122714011 AGAGGCTGAGAAAAGTCTTAGGG + Intronic
966574364 3:181482975-181482997 AACTGATTAGGAAAGTGTCATGG - Intergenic
968113728 3:196072404-196072426 ATCTGCTTAGGATAGTTTTAGGG + Intronic
970889238 4:21024022-21024044 AACGGCTTTGGAAAACCTTCTGG + Intronic
976364792 4:84221500-84221522 AATGTCTTAGAAATGTCTTAAGG + Intergenic
978230385 4:106390548-106390570 AATGGATTAGGAATGTCATATGG - Intergenic
987058429 5:14218569-14218591 AAAGTCTCAGGCAAGTCTTAAGG + Intronic
989540537 5:42613173-42613195 AACAGCTTAGGAAAGCTATATGG - Intronic
993766862 5:91870462-91870484 AAAGACTTATGAAACTCTTAGGG + Intergenic
994722910 5:103401239-103401261 TACTGCTTAGGAAACTCTAAGGG - Intergenic
996970319 5:129359177-129359199 AACTTCTTGGGTAAGTCTTAGGG + Intergenic
997285905 5:132678290-132678312 AAGGGCTTAGGAAATGCTTATGG + Intronic
998582792 5:143397996-143398018 AACATCTTAGGAAACTCTTGGGG - Intronic
1005581708 6:27241462-27241484 AAAGCTTTAGGAAAGGCTTATGG + Intergenic
1006799791 6:36752567-36752589 AACGGAATAGGTAAGTGTTAAGG - Intronic
1017781988 6:157722391-157722413 ACCGGCTCAGGCAAGACTTAAGG - Intronic
1021983216 7:26074905-26074927 AACTGATCAGGAAAGTGTTAGGG - Intergenic
1023023164 7:36028758-36028780 AATGGCCTCGGAAACTCTTACGG - Intergenic
1024104147 7:46064768-46064790 AAAGGCTTAGTGAAGTCTCATGG + Intergenic
1024736396 7:52309457-52309479 AAAGGCTAAGGGAAGTCATAAGG + Intergenic
1030111677 7:106032131-106032153 AAAGGCTTAGGAGCGTCTCAAGG - Intronic
1030807749 7:113937479-113937501 AGCTGCTTAGAGAAGTCTTAGGG - Intronic
1041597410 8:59672115-59672137 AATGGCTTAGGAAAGTATTATGG + Intergenic
1041871132 8:62635490-62635512 AACTGCTTAGGAAAGTGCTATGG + Intronic
1045895808 8:107215233-107215255 ACCTGCCTAGGAAAGTCTTGGGG - Intergenic
1049047458 8:140164307-140164329 GACGACTTAGGAAATTTTTAGGG - Intronic
1057250491 9:93497304-93497326 AACGGCTTAGGAAAGTCTTAGGG + Intronic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1188579488 X:31692742-31692764 AACAGCTAAGGAAAGAGTTAAGG + Intronic
1193582022 X:83277042-83277064 AGTGGCTTGGGAAAGTCTCAGGG - Intergenic