ID: 1057253420

View in Genome Browser
Species Human (GRCh38)
Location 9:93522917-93522939
Sequence CAGCACTGAGACCTAGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057253418_1057253420 19 Left 1057253418 9:93522875-93522897 CCACAGGAAGGCAGGCTGTTTGG 0: 1
1: 0
2: 2
3: 25
4: 252
Right 1057253420 9:93522917-93522939 CAGCACTGAGACCTAGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057253420 Original CRISPR CAGCACTGAGACCTAGCTGT TGG Intronic
No off target data available for this crispr