ID: 1057253959

View in Genome Browser
Species Human (GRCh38)
Location 9:93527925-93527947
Sequence GGTAGAAGTAGAAGAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 0, 2: 5, 3: 59, 4: 631}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057253959 Original CRISPR GGTAGAAGTAGAAGAAAAGC AGG (reversed) Intronic
900055911 1:630497-630519 GGTAGAAGTAGAGGTTAAGGAGG - Intergenic
900947456 1:5839097-5839119 GGCAGAAGCAGAAGAACAGCAGG + Intergenic
903990660 1:27266200-27266222 GGTAGAGGAAGAGGAAAAGTAGG - Intronic
904444884 1:30562647-30562669 GGCAGAAGCAAAAGAACAGCAGG + Intergenic
904543085 1:31247142-31247164 GGTGGAAGTTAAAGAAAAGAGGG - Intergenic
905021680 1:34819642-34819664 GGTATAAGTAGAAGGTAGGCAGG + Intronic
905678037 1:39843691-39843713 GGAAGAAGCAGAAGCATAGCTGG - Intronic
906119597 1:43380185-43380207 GGTAGAAGAAGAAGAAAAGGGGG + Intergenic
906324306 1:44834867-44834889 GGTAGAATTAGAATAAATGCAGG + Intronic
906645729 1:47473011-47473033 AGTATTAGTAGAAGAAATGCTGG + Intergenic
907549189 1:55289685-55289707 GCAGGAAGTAGAAGAAAAGGAGG - Intergenic
907965656 1:59326084-59326106 GGAAGAAGGAGAAGATAAGCTGG + Intronic
908036225 1:60057017-60057039 GGTAGCACAAGAAGAAAAGAAGG + Intronic
908713518 1:67044646-67044668 GATAGAAGTAGTAGAAAACATGG - Intronic
909304784 1:74060341-74060363 GGAGGAAGAAGAAGAAAAGGAGG - Intronic
909630166 1:77762446-77762468 GGAAGAAAAAGAAGAAAAGAAGG + Intergenic
910568433 1:88672848-88672870 GGTTGAAATATAAGAAAATCTGG + Intergenic
910894612 1:92055127-92055149 GGGAGAAAAAGAAGCAAAGCAGG + Intronic
911409152 1:97480022-97480044 GAAAGAAATAGAAGAAAAGCAGG - Intronic
911598412 1:99822918-99822940 GGTAGAGGTAGAGGAAGAGGAGG - Intergenic
911820116 1:102407900-102407922 GATAGAAATAGAAGTAAAGGTGG + Intergenic
912451343 1:109769441-109769463 GGTGGAAGTAGCAGGAAGGCAGG + Intronic
912903951 1:113683499-113683521 GGTAAGAGTCGAAGAATAGCAGG + Exonic
913009167 1:114665829-114665851 TGTAGAATTAGAAGAGAAGAGGG - Intronic
913083585 1:115413097-115413119 GGAAGAAGAAGAAGAAGAGGAGG + Intergenic
913224586 1:116687668-116687690 GAAAGAAGGAGAAGAAATGCCGG - Intergenic
913239305 1:116815474-116815496 ATGAGAAGTAGAAAAAAAGCAGG - Intergenic
913242934 1:116845860-116845882 TGGAGAGGGAGAAGAAAAGCTGG + Intergenic
913247441 1:116882461-116882483 GGTAAAAGAAGAAGACAAACTGG + Intergenic
913524237 1:119675964-119675986 GGAAGAAGGAGCTGAAAAGCAGG + Intronic
914964034 1:152237143-152237165 GGAAGAGGTAGAAGAAGAGCTGG - Intergenic
915702418 1:157808696-157808718 TATAGAAGTGAAAGAAAAGCAGG + Intronic
915778994 1:158524460-158524482 TGAAGAAGAAGAAGAAAAGAAGG + Intergenic
916316504 1:163454397-163454419 GGTAGAATTAGAAGATTAGTAGG + Intergenic
916738639 1:167629839-167629861 GGGAGAGGAAGAAGGAAAGCAGG + Intergenic
916746641 1:167689948-167689970 GGCAGAAGGAGAAGAGAAGTTGG - Intronic
916871375 1:168918253-168918275 GGAGGAGGAAGAAGAAAAGCAGG - Intergenic
917748329 1:178032123-178032145 GGTAGTTTTAGTAGAAAAGCTGG - Intergenic
917815052 1:178699979-178700001 GGTAGAAATGGCAGCAAAGCTGG + Intergenic
918104146 1:181401981-181402003 AGAAGAAGTAGAAGAAATGTAGG + Intergenic
918586671 1:186196152-186196174 TGTAAAAATAGAAGAAAACCTGG - Intergenic
919860137 1:201734434-201734456 GGAAGAAGAAGAAGAAGAGGAGG + Intronic
919966691 1:202533910-202533932 GGTAAAAGTAGAGGAGAAACTGG - Intronic
920063265 1:203244058-203244080 GGTAGAAGGAGAAGAAGAAGGGG + Intronic
920240567 1:204545635-204545657 GGTAGCATTAGAAGGAATGCAGG + Intronic
920620305 1:207539823-207539845 GGAAAAAGAAGTAGAAAAGCTGG + Intronic
920622087 1:207558380-207558402 GGAAAAAGAAGTAGAAAAGCTGG + Intronic
920662720 1:207931113-207931135 GGAAGTGGCAGAAGAAAAGCTGG - Intergenic
920676060 1:208039571-208039593 GGCAGAAGTAGAAGATACACAGG + Intronic
921379454 1:214509381-214509403 GGAAGCTGCAGAAGAAAAGCTGG - Intronic
921623467 1:217352226-217352248 GGCAGAAGAAAAAGAAAAGGAGG + Intergenic
921708299 1:218348144-218348166 GGAAGAAGAAAAAGAAAAGTGGG + Intronic
921991248 1:221370198-221370220 GGTAGAAGTAGAAGGAAAGGAGG - Intergenic
922044660 1:221932882-221932904 ATTATAAGTAAAAGAAAAGCTGG + Intergenic
922336213 1:224620167-224620189 GGAAGAAGCAGAAGAAAACTAGG + Intronic
922627649 1:227065707-227065729 GGTAAAAGTAGGAGTAAAGAAGG + Intronic
922691553 1:227696165-227696187 GGTGGGAGTAGAAGCACAGCTGG + Intergenic
923127754 1:231047275-231047297 GGAAGGAGTGGAAGAAAAGGAGG - Intergenic
923298378 1:232616853-232616875 AGTAGAAGAAATAGAAAAGCGGG + Intergenic
924091579 1:240507190-240507212 GGTAGAGTAAGAAGAAAAGTGGG + Intronic
924106246 1:240652238-240652260 AGTAGAAGTGGAAGACAAGATGG - Intergenic
924208531 1:241740931-241740953 AGTAGAAGTAGATGAGGAGCAGG - Intronic
924323462 1:242872204-242872226 GGTGGTAGAGGAAGAAAAGCTGG - Intergenic
924389629 1:243539163-243539185 GGCAGATGCAGAAGAAAATCCGG - Intronic
924608653 1:245556220-245556242 GGAAGAAGAAGAAGAAGAGGAGG - Intronic
1062801254 10:382266-382288 GGTAACACTACAAGAAAAGCAGG + Intronic
1063594646 10:7423103-7423125 AGAAGAAGCAGAAGAAAAGGAGG + Intergenic
1063705896 10:8430532-8430554 GGTCGAGGTAGGAGAATAGCTGG - Intergenic
1063803656 10:9611997-9612019 GGAAGAAGAAGAAGAAGAGGAGG + Intergenic
1063868910 10:10397277-10397299 GGGAGAAGGAAAAGAAAAGGAGG + Intergenic
1064546233 10:16452716-16452738 AGTAGAAGTAGAAGAAGAAGAGG - Intronic
1064627265 10:17273937-17273959 AGAAGAAGAAGAAGAAAAGAAGG - Intergenic
1064920988 10:20517967-20517989 TGTAGAAATAACAGAAAAGCAGG - Intergenic
1065395124 10:25228042-25228064 AGTAGAAGTAGAGAAAAAACAGG - Intronic
1065402695 10:25323946-25323968 GGTAGCTGAAGAAGAAAAGTTGG - Intronic
1066237882 10:33504616-33504638 GGAAGCTGCAGAAGAAAAGCTGG - Intergenic
1067573046 10:47385585-47385607 GGTGGAAGTGGAAGCAAAACAGG + Intergenic
1068922663 10:62501081-62501103 CTTACAAGTAGAACAAAAGCTGG - Intronic
1069153898 10:65000772-65000794 AGTAGTGGAAGAAGAAAAGCTGG - Intergenic
1069168398 10:65193702-65193724 GATACAAGTAGAAAAAAGGCTGG - Intergenic
1069737182 10:70664536-70664558 GTTAGGATTGGAAGAAAAGCCGG + Intergenic
1070619949 10:78001693-78001715 GGTTGAAGCAGAAGAAAGCCAGG - Intronic
1071290322 10:84184420-84184442 GGTAGAAGAGGAAGAGAAGGTGG - Intronic
1071371058 10:84952350-84952372 GGTAGAAGGTGAAGAGAAGATGG + Intergenic
1071436994 10:85656601-85656623 GGGAGAACTAGAGGAAGAGCAGG - Intronic
1071794213 10:88988245-88988267 GGAAGAAGAAGGAGAAAGGCAGG + Intronic
1072517575 10:96200994-96201016 AGTGGAATTAGATGAAAAGCTGG + Exonic
1072593808 10:96852701-96852723 GGTAGAAGTAGAAGCAATGGTGG + Intronic
1072601004 10:96929435-96929457 GGAAGCTGCAGAAGAAAAGCTGG - Intronic
1072674011 10:97452227-97452249 GGTAGTAGTGGAAGACAATCAGG - Exonic
1073108773 10:101048399-101048421 GGTAGGAGGAGAAGAAAGGAAGG - Intergenic
1073279486 10:102342476-102342498 GGTAGTAGGGGAAGAGAAGCAGG + Intronic
1074321551 10:112407711-112407733 GGTAGAGGTAGATTAAAAGAAGG - Intronic
1075271850 10:121059300-121059322 GAGAGAACTACAAGAAAAGCTGG + Intergenic
1075921976 10:126221081-126221103 GGTAGATTTAGAAGAGAAGGAGG + Intronic
1077447899 11:2608916-2608938 GGGAGAGGGAGAAGAAAAGAAGG - Intronic
1078224566 11:9380161-9380183 AGAAGAAGAAGAAGAAGAGCTGG - Intergenic
1078692955 11:13600472-13600494 GGAAGAAGAAGAAGAAGAGGAGG - Intergenic
1081411492 11:42763823-42763845 GGCAGATGCAGAAAAAAAGCTGG - Intergenic
1081512100 11:43785584-43785606 GGTTGAAGTAGAAGGAAATCTGG + Intronic
1082007092 11:47425455-47425477 GGTAGTATTGGAATAAAAGCAGG + Intronic
1083350749 11:62027202-62027224 GATAGAAGCAAAAGAACAGCAGG - Intergenic
1083768089 11:64851792-64851814 GGTAGAAGCAGATGCAAACCAGG - Exonic
1084309911 11:68311080-68311102 AGTAGAAGTGTAAGAAGAGCTGG + Intergenic
1085228027 11:74940376-74940398 GGAAGAAGTAGAAGAAGAGCTGG + Intronic
1085366353 11:75949249-75949271 GGGAGAAGCAGAAGGACAGCTGG - Intronic
1085623229 11:78052900-78052922 AGAAGAAGAAGAAGAAAAGAAGG - Intronic
1086406427 11:86503044-86503066 GGGAGAAGCAGAAGAAGAGGAGG - Intronic
1086727702 11:90209134-90209156 GGTAGAAGTAGTAGATAAAAGGG - Intronic
1086755349 11:90554863-90554885 GGGAGAAGGAGAAGAAAAGAAGG - Intergenic
1086993781 11:93333674-93333696 GGTAGAAAGACAAAAAAAGCAGG + Intronic
1087159515 11:94935319-94935341 GGTAGGAGGAGAAGAAAATCAGG + Intergenic
1088015272 11:105050774-105050796 GGCAGAAGCAGAAGAAGAGGTGG + Intronic
1090126762 11:124094220-124094242 GGAAATGGTAGAAGAAAAGCTGG + Intergenic
1090865107 11:130693044-130693066 GTTAGGATAAGAAGAAAAGCTGG - Intronic
1090967268 11:131609904-131609926 GGTAGAAGCAAAAGAAAAACAGG - Intronic
1090969038 11:131623843-131623865 GCTAACAGTGGAAGAAAAGCAGG - Intronic
1091042640 11:132296322-132296344 GGTAGAAGTAGTAGAGGAGTGGG + Intronic
1091801110 12:3325021-3325043 CGTAGAAGTAAGAGAGAAGCAGG - Intergenic
1091874600 12:3923711-3923733 GGTGGGAGTAGAATAAAAGGAGG - Intergenic
1092812593 12:12285690-12285712 GGGAGAAGGACAAGAACAGCTGG + Intergenic
1092951753 12:13510043-13510065 GGTAGAAGCAGTAGAGATGCAGG + Intergenic
1093331742 12:17851881-17851903 GGGAGCAGTGGAAGAAAAGTGGG - Intergenic
1093866251 12:24230383-24230405 GGTAGAAAAAGAAAAAAAGCTGG + Intergenic
1095308444 12:40665148-40665170 GGAAGCAGCAGAAGAAAAGTTGG + Intergenic
1095804115 12:46299577-46299599 GGGAGAAGTAGAAAAAAAAATGG + Intergenic
1095933278 12:47650708-47650730 AGGGGAAGTAGAAGAAAAGCAGG + Intergenic
1096193543 12:49634730-49634752 GGTGCAAGGGGAAGAAAAGCTGG + Intronic
1096439197 12:51624920-51624942 GGTAGAGGAAAAAAAAAAGCTGG - Intronic
1096528383 12:52228023-52228045 AGAAGAAGAAGAAGAAGAGCTGG - Intergenic
1096581253 12:52586982-52587004 TGAAGAAGGAGAAGAAAAACAGG + Intronic
1097502512 12:60422841-60422863 GATAGAAGTAGAGGAAGGGCAGG - Intergenic
1097587208 12:61529319-61529341 GATATAAGTGGAAGAAAACCTGG - Intergenic
1098103459 12:67043592-67043614 GGGGGGCGTAGAAGAAAAGCTGG - Intergenic
1098225040 12:68312562-68312584 GGTAGTAGTAGAGCAAGAGCTGG - Intronic
1098882258 12:75928536-75928558 GGTGGAAGGAGAAGAGGAGCTGG - Intergenic
1099427632 12:82544231-82544253 GATAGCAGTAGAATAATAGCAGG - Intergenic
1100126326 12:91430841-91430863 GGCAGGGGTAGAAGAAATGCAGG - Intergenic
1100398857 12:94209973-94209995 GGTTGAACTGGAAGAAAAGTTGG + Intronic
1100402189 12:94241992-94242014 AGAAGAAGAAGAAGAAAAGGAGG + Intronic
1101273038 12:103168175-103168197 GGTGTAAGCAGAAGAAAAGTGGG - Exonic
1101338540 12:103819662-103819684 GGGATAAGCAGACGAAAAGCTGG - Intronic
1101620542 12:106383113-106383135 GGAAGAGGCAGAAGAAAAGTTGG - Intronic
1101677629 12:106932983-106933005 GGAAGCTGCAGAAGAAAAGCTGG + Intergenic
1102443514 12:112982397-112982419 GGTAGATGTAGAAGAACATTTGG - Intronic
1103104318 12:118209693-118209715 AGAAGAAGAAGAAGAAGAGCCGG - Intronic
1103147572 12:118608975-118608997 GGGAGAAAAAGAAGAAAAGAGGG + Intergenic
1103467965 12:121157059-121157081 GATAAACTTAGAAGAAAAGCTGG - Intronic
1104488381 12:129172206-129172228 GGAAGCTGCAGAAGAAAAGCTGG - Intronic
1104534027 12:129601224-129601246 GGAAGCTGAAGAAGAAAAGCTGG - Intronic
1106330359 13:28733822-28733844 GGTAAAAGTAGAAGGAGAGGTGG - Intergenic
1106434363 13:29710704-29710726 GGTGTAAATAGAAGAAAAGGTGG - Intergenic
1106588649 13:31079220-31079242 GTTAGAGGGAGAAGATAAGCAGG - Intergenic
1107204820 13:37771769-37771791 GGTATATGTAGAAGAAAAAAAGG + Intronic
1107305486 13:39014001-39014023 GGTAGAAGCAGCAGAAGAGCTGG + Exonic
1107777724 13:43864477-43864499 GGTAGAAGGTGAAGAGGAGCTGG + Intronic
1108247698 13:48533481-48533503 GCCAGCAATAGAAGAAAAGCTGG - Intergenic
1108266152 13:48711062-48711084 GGTAGAAGCAGAAGAAAGAATGG + Exonic
1109083605 13:57941154-57941176 GGTAGAAGATCAAGAAAACCTGG + Intergenic
1110533593 13:76625821-76625843 GGGAGAAGGAGAAGAAGAGAAGG - Intergenic
1110661523 13:78063551-78063573 GGCAGAAGTAGAAGAAATGGAGG - Intergenic
1111155849 13:84323717-84323739 GGTACAAGTAGCAGATATGCAGG + Intergenic
1111568708 13:90049283-90049305 ACTAGAAACAGAAGAAAAGCTGG - Intergenic
1112284968 13:98096173-98096195 GGGAGAAGTATGAGAAAAGTAGG - Intergenic
1112837989 13:103539499-103539521 GGTAGAAGCAGCAGAGAAGCCGG - Intergenic
1113255506 13:108500553-108500575 GGAAGAAGGAGAAAAACAGCAGG - Intergenic
1113371278 13:109727746-109727768 GGTAGAAGAAGAAAAGAACCTGG - Intergenic
1113585190 13:111459925-111459947 GGGAGAAGGAGAGGAAAAGAGGG + Intergenic
1113585235 13:111460104-111460126 GGGAGAAGGAGAGGAAGAGCAGG + Intergenic
1113728038 13:112619740-112619762 GGCAGAAGCAAAAGAACAGCAGG + Intergenic
1113985285 13:114310020-114310042 GGTTGAAGAAAAAAAAAAGCAGG - Intergenic
1114967016 14:27974923-27974945 TACAGAAGTAGAAGAAAAGATGG - Intergenic
1115927817 14:38456655-38456677 TGTTGAAGAAGAAGAAAGGCAGG - Intergenic
1116299139 14:43154686-43154708 AGAAGAAGAAGAAGAAAAACAGG - Intergenic
1116596379 14:46852375-46852397 GGTGCAAGTAGAGGAAAAGAAGG + Intronic
1117464675 14:55980736-55980758 GGAAGCTGCAGAAGAAAAGCTGG + Intergenic
1118172019 14:63396544-63396566 GGAAGAAGGAGAAGCAAAGTTGG - Intronic
1118517946 14:66547135-66547157 GGAAGAATTAGAATTAAAGCAGG + Intronic
1118737657 14:68713647-68713669 GGGAGAAGCAGAGCAAAAGCTGG + Intronic
1119067343 14:71542252-71542274 GGAAGAAGAAGAAGAAGAGGAGG - Intronic
1119766499 14:77192882-77192904 GGAAGGAGAAGAAGAAAAGGAGG + Intronic
1121851424 14:97224400-97224422 GGAAGAAGAGGAAGAAAAGAGGG + Intergenic
1122018331 14:98816303-98816325 GGAAGAAGAAGAAGAAATTCTGG - Intergenic
1122282954 14:100635037-100635059 GGAAGAAGCAGAAAAGAAGCTGG + Intergenic
1122837989 14:104440404-104440426 GGAAGCTGCAGAAGAAAAGCTGG - Intergenic
1124012284 15:25848658-25848680 TGTAAAAGTGGAAGAAAAGCGGG - Intronic
1124573674 15:30888779-30888801 TGAAGAAGCAGAAGAAAATCTGG + Intergenic
1124588320 15:31031459-31031481 GGAAGAATTAGAAGAAAAGATGG + Intronic
1125201745 15:37106478-37106500 GGGAGAAATAAAAGAAAAGGGGG - Intergenic
1125301462 15:38257978-38258000 GAAAGATGGAGAAGAAAAGCAGG - Intronic
1125415373 15:39447098-39447120 GAGAGAAGTGGAAGAAAAGTAGG - Intergenic
1125875396 15:43139761-43139783 GGAAGCAGCAGAAGAAAAGTTGG + Intronic
1126208292 15:46071383-46071405 GGTAGAGGTAGTAGAGTAGCAGG + Intergenic
1126689604 15:51279072-51279094 GGTAGAAAAAGGAGAAATGCAGG - Intronic
1127552145 15:60051087-60051109 GGAAGAAGTAGAGTCAAAGCAGG - Intronic
1128095599 15:64952079-64952101 GGAAGAAGAGGAAGAAAAGAAGG - Intronic
1128095745 15:64953670-64953692 GGGAGAAGGAGAAGAAAAGAAGG - Intronic
1128266472 15:66271071-66271093 GGAAGAAGAAGAAGAAGAGGAGG + Intergenic
1128685664 15:69683306-69683328 GGAAGCTGTAGAAGAAAAGTTGG - Intergenic
1129289331 15:74551749-74551771 GTTAGGAATAGAAAAAAAGCTGG - Intronic
1129534985 15:76306107-76306129 GGTAGAAGAAGAAAAAAAGCTGG + Intronic
1130335455 15:82953402-82953424 AGTAGAACTTGAAGAAGAGCAGG + Intronic
1130645790 15:85725583-85725605 GGCAGAGGTAGAAGAAAAGGTGG + Intronic
1131104925 15:89727085-89727107 GGAAGAAGTAGGGGAAAATCAGG + Intronic
1131222219 15:90594520-90594542 GGAGGAAGGAGAAGAAAGGCGGG + Intronic
1131619976 15:94057885-94057907 TGGCCAAGTAGAAGAAAAGCAGG - Intergenic
1133355736 16:5135383-5135405 GCCAGAAGGAAAAGAAAAGCGGG + Intergenic
1133931691 16:10238061-10238083 GGTTAAAGTAGACGAATAGCAGG - Intergenic
1134060010 16:11193715-11193737 GGAGGAAGAAGAAGAAGAGCAGG - Intergenic
1134343129 16:13363622-13363644 GGTAGAACTGGAACAAATGCAGG + Intergenic
1134358415 16:13506430-13506452 AGTAGAAATTGAAGAAAAGCAGG + Intergenic
1134512403 16:14859093-14859115 AGTAGAATTAGAAGAACAGTAGG + Intronic
1134700039 16:16257593-16257615 AGTAGAATTAGAAGAACAGTAGG + Intronic
1134760248 16:16708278-16708300 GGTAGAGGTATAAGCAAAACTGG - Intergenic
1134971785 16:18537066-18537088 AGTAGAATTAGAAGAACAGTAGG - Intronic
1134985824 16:18650927-18650949 GGTAGAGGTATAAGCAAAACTGG + Intergenic
1135934754 16:26770382-26770404 GGTGGAGGAAGAAGAAAAGAAGG + Intergenic
1136427212 16:30176918-30176940 GATAGAAGTCTAAGAAATGCTGG - Intergenic
1137935387 16:52630280-52630302 GGTAGAGGCAGAAGAACAGGTGG + Intergenic
1138061676 16:53898026-53898048 GGTAGTAGAAGCAGGAAAGCTGG - Intronic
1138142328 16:54579491-54579513 GGAAGAAGAAGAAGAAGAGGAGG + Intergenic
1138191155 16:55015530-55015552 GGTAGAAGTAGAAGACAGTATGG - Intergenic
1138323980 16:56145475-56145497 GGTAGAAGGAGGAGAGGAGCTGG + Intergenic
1138887646 16:61098875-61098897 GGAAGAAGAAGAAGAAGAGGAGG + Intergenic
1138895025 16:61193735-61193757 AGTAGTAGTAGAACAAAAGCAGG + Intergenic
1140030601 16:71335174-71335196 TGTAGAAAGAGAAGAAAAGGAGG - Intergenic
1142712243 17:1730008-1730030 AGAAGAAGAAGAAGAGAAGCAGG + Intronic
1142900487 17:3008424-3008446 GGTAGCAGTAGGAGAGGAGCTGG + Intronic
1143224525 17:5289155-5289177 GGAAGAAGAAGAAGAAAGGGAGG - Intronic
1143532493 17:7513396-7513418 GGGAGAAGTGGGAGAATAGCTGG - Exonic
1143924967 17:10361588-10361610 GCTAGAAGTAGAAGCAAGGCTGG - Intronic
1143933302 17:10454602-10454624 GAAAGAACTAGAAGAAAAGATGG - Exonic
1144382150 17:14711094-14711116 GGAAGAAGAAGAAGAAAAGAAGG - Intergenic
1147948930 17:44096217-44096239 GAAAGAAGTAGAAGAGAAACAGG - Intronic
1148318353 17:46724820-46724842 GGCAGAAGAAGAAGAAAAAAAGG - Intronic
1148523175 17:48301575-48301597 GGCTGAAGTAGAAGAATTGCTGG - Intronic
1148948038 17:51282843-51282865 AGAAGAAGAAGAAGAAAAGGAGG - Intronic
1149070928 17:52541804-52541826 GGCAGAAGTAGAAGAATTGTGGG + Intergenic
1149441135 17:56674995-56675017 GGAAGAAGAAGAAGAAGAGGAGG - Intergenic
1149530186 17:57388954-57388976 AGAAGAAGAAGAAGAAGAGCAGG - Intronic
1149690494 17:58571604-58571626 GGAAGAAGTAGAAGAAGAGGAGG + Intronic
1149864160 17:60141198-60141220 GGTAGAGGCAGAAGTCAAGCAGG + Intergenic
1150643090 17:66962841-66962863 GGAAGAAGAAGAAGAAGAGATGG + Intergenic
1150723330 17:67631901-67631923 GTGAGAGGTAGAAGAAAAACTGG - Intronic
1151348437 17:73517397-73517419 GGTAGGAGGAGAAGAAACACAGG + Intronic
1151377636 17:73701856-73701878 GGAAGCGGTAGAAGAAAAGTTGG - Intergenic
1151442974 17:74145583-74145605 TGTGGAACTAAAAGAAAAGCTGG - Intergenic
1151871785 17:76841584-76841606 GGTAGAAGGAAGACAAAAGCTGG + Intergenic
1152365313 17:79852545-79852567 AGAAGAAGAAGAAGAAAAGAAGG - Intergenic
1152648163 17:81479814-81479836 TGGAGAAGCTGAAGAAAAGCAGG - Intergenic
1153583989 18:6602616-6602638 GGTACCAGCAGAAGAGAAGCCGG + Intergenic
1153584974 18:6611791-6611813 AGCAGCAGTAGAAGAAGAGCTGG + Intergenic
1153809061 18:8735661-8735683 GGTGGAAGTTGAATGAAAGCAGG + Intronic
1153837195 18:8974446-8974468 GGCAGAACTTGAGGAAAAGCAGG + Intergenic
1153977088 18:10278795-10278817 GGGAGAGGTAGAGGAACAGCTGG + Intergenic
1154127771 18:11707903-11707925 GGAAGCTGCAGAAGAAAAGCTGG - Intronic
1154249417 18:12731055-12731077 GGAAGCTGCAGAAGAAAAGCTGG - Intergenic
1155602481 18:27565518-27565540 GGGAGAAGTAAGAGAAAAGAAGG + Intergenic
1155828818 18:30485324-30485346 GAGAGAAGTAGTAGAAAAACAGG + Intergenic
1156096830 18:33543788-33543810 GGTAGAGTTAGAACAAAAGAGGG + Intergenic
1156396442 18:36704075-36704097 GGAAGAAGTAATAGAAAAGAAGG - Intronic
1156854798 18:41769091-41769113 CTTAGAAGAAGAAGAAAATCTGG + Intergenic
1157570254 18:48707546-48707568 GGAAGAAGAAGAAGAAGAGGAGG - Intronic
1157688773 18:49664185-49664207 GGTTGGAGTAGAAGTAGAGCAGG - Intergenic
1158212029 18:55062249-55062271 GGAAGCTGCAGAAGAAAAGCTGG - Intergenic
1158431216 18:57389312-57389334 TTTACAAGTAGAAGAAAAGAAGG - Intergenic
1159079760 18:63724085-63724107 GGAAGAAGAAGAAGAAGAGGAGG - Intronic
1159134987 18:64327051-64327073 AATATAGGTAGAAGAAAAGCTGG - Intergenic
1159198053 18:65143811-65143833 GGTAGTAGTGGAAGGAAGGCAGG + Intergenic
1159432925 18:68379082-68379104 GGAAGAAATATAATAAAAGCAGG + Intergenic
1159468724 18:68821643-68821665 GGAAGAAGGAGAAGAAAAGAAGG - Intronic
1159874220 18:73792481-73792503 GGAAGAAGTAGAGGAAAAGGAGG - Intergenic
1160166118 18:76513934-76513956 GGAAGATGCAGAATAAAAGCTGG - Intergenic
1160218070 18:76951481-76951503 GGGAGCTGCAGAAGAAAAGCTGG - Intronic
1160230906 18:77048275-77048297 TGCAGAGGTAGAAGGAAAGCTGG + Intronic
1160552112 18:79700546-79700568 GGAAGCTGCAGAAGAAAAGCTGG + Intronic
1161373522 19:3927118-3927140 GGCTGAGGTAGAAGAATAGCTGG + Exonic
1162608338 19:11729708-11729730 GGTAGTAATAAAAGAAAAACTGG + Intronic
1163061300 19:14764030-14764052 GGAAGAAGAAGAAGAAGAGAAGG - Intronic
1164250021 19:23468100-23468122 AGGAGAAGAAGAAGAAAAGGAGG - Intergenic
1164302444 19:23973637-23973659 AGAAGGAGTAGAAGGAAAGCAGG + Intergenic
1164784563 19:30919792-30919814 GTTACAAGAAGAAGAAAAGGAGG + Intergenic
1164929488 19:32164549-32164571 GGAAGAAGAAGAAGAAGAGGAGG + Intergenic
1164929495 19:32164585-32164607 GGAAGAAGAAGAAGAAGAGGAGG + Intergenic
1164960636 19:32426180-32426202 GGAAGCTGCAGAAGAAAAGCTGG - Intronic
1165508828 19:36254016-36254038 GGTGGAAGCAAAAGAACAGCAGG + Intergenic
1165631865 19:37308032-37308054 GGTGGAAGCAAAAGAACAGCAGG - Intergenic
1165644267 19:37420601-37420623 AGTAGAATTAGAAGTAGAGCCGG - Intronic
1166184224 19:41128878-41128900 GGAAGAAGAAGAAGAAGAGGAGG + Intergenic
1167153912 19:47726486-47726508 GGAAGAAGAAGAAGAGAAGGAGG - Intronic
1167540559 19:50084620-50084642 GGTGGAAGGAGAAAGAAAGCAGG + Intergenic
1167629156 19:50613195-50613217 GGTGGAAGGAGAAAGAAAGCAGG - Intergenic
1167812236 19:51843850-51843872 GGAAGAAGTGGAAGAAATGGGGG + Intergenic
926510488 2:13771213-13771235 GGTAGAAAGAAAAGAAAAGAAGG + Intergenic
926619476 2:15034074-15034096 GGAAGAAGAAGAAGAAGAGGAGG + Intergenic
927420226 2:22923266-22923288 GATAGAAGTAGAAGTAATCCTGG - Intergenic
927696027 2:25240418-25240440 GGTAGAACTCAAAGAAGAGCCGG + Exonic
927700829 2:25267854-25267876 GGTAGAGGCAGAAAACAAGCTGG + Intronic
927715642 2:25350448-25350470 GGCGGAAGGGGAAGAAAAGCAGG - Intergenic
927866197 2:26589227-26589249 AGGAGAAGTAGAAGAAGAGGGGG - Intronic
928231240 2:29500526-29500548 GGTAGAAGAAAAAGAATAGGTGG - Intronic
928638427 2:33272296-33272318 GTTTGAATGAGAAGAAAAGCAGG - Intronic
928703321 2:33921240-33921262 AGTAGAAGTAAAAGAAAACAAGG + Intergenic
928933416 2:36648881-36648903 GGTGAAAGAAGAAGGAAAGCTGG + Intergenic
930352315 2:50272593-50272615 AGTAAAAGTAGACTAAAAGCAGG + Intronic
931188490 2:59976739-59976761 GGAGGAAATAGAACAAAAGCAGG + Intergenic
931227367 2:60343024-60343046 GGAAAAAGAAGAATAAAAGCTGG + Intergenic
932469571 2:71945071-71945093 GGAAGAAAGAGAAGAAAAGGGGG + Intergenic
932898129 2:75664540-75664562 GGTAGGATTTGAAAAAAAGCAGG - Exonic
933153988 2:78950808-78950830 GGTAGAGGTAGAAGTAGAGATGG - Intergenic
933301999 2:80551616-80551638 GGAAGCTGCAGAAGAAAAGCTGG - Intronic
933330489 2:80887170-80887192 TGTAGAAGCAGAAGAAGAGGAGG - Intergenic
933799113 2:85945708-85945730 GGTGGAAGTCAAAGCAAAGCTGG + Intergenic
934736457 2:96692117-96692139 GGTAGATGTAGCAGAAGAGCTGG - Intergenic
935456756 2:103278550-103278572 GGTAAAAGTAAAATAAATGCAGG + Intergenic
935463102 2:103362063-103362085 AGAAGAAGAAGAAGAAAAGGAGG - Intergenic
935953509 2:108352265-108352287 GGAAAAAGTAGAAGAAATGCTGG - Intergenic
936237248 2:110753194-110753216 GGTAGAAGTAGAAGGCAAAAGGG - Intronic
936548143 2:113410806-113410828 GGTAGAAGGTGAAGGAGAGCTGG - Intergenic
937360950 2:121229858-121229880 GGGAGAAGTAGAGAAAATGCAGG - Intronic
937391942 2:121496562-121496584 GAGAGACATAGAAGAAAAGCTGG + Intronic
937399758 2:121572085-121572107 GGCAGAATTAGAAGAAAAAAAGG + Intronic
937520106 2:122703376-122703398 GGGAGAAGGAGAAGAAAAAGAGG + Intergenic
937630738 2:124098363-124098385 GGCAGAAGTGGAAGAAAATCTGG + Intronic
938993206 2:136650761-136650783 GGTGAAAGCAGAAGAAAACCAGG - Intergenic
939216223 2:139242002-139242024 GCTAGAATTAGAAGAAATGTTGG + Intergenic
939645604 2:144694638-144694660 GGTATAAGTAGAAAAACTGCAGG - Intergenic
939734517 2:145827381-145827403 GGAAGAAGAAGAAGAAGAGGAGG - Intergenic
940440963 2:153715808-153715830 AGAAGAAGAAGAAGAAAAGAGGG - Intergenic
941492493 2:166159654-166159676 GGGAGAAGGAGAAGAAGAACTGG - Intergenic
941749271 2:169118363-169118385 GGCAGAAGCAAAAGAACAGCAGG - Intergenic
942391027 2:175493174-175493196 GGAAGAAGGAGAAGGAAAGGAGG + Intergenic
942602421 2:177654851-177654873 GGAAGAAGTAGGAAAGAAGCAGG - Intronic
942646889 2:178121824-178121846 GGAAGAAGCAGGAGAGAAGCAGG - Intronic
942852384 2:180504192-180504214 GTGAGAATCAGAAGAAAAGCAGG - Intergenic
944138233 2:196424705-196424727 GGAAGCTGCAGAAGAAAAGCTGG + Intronic
944362276 2:198871053-198871075 TGTAGAAGTGGAAGAAAATAGGG + Intergenic
944435143 2:199680992-199681014 TGGAGAAGTGGAAGAAAAGTGGG + Intergenic
944531524 2:200672703-200672725 GGAAGAAGTAGAAGTGGAGCAGG + Intronic
944695930 2:202200491-202200513 GGGAGAAGTACAAGGAAAGAAGG + Intergenic
944787367 2:203086833-203086855 ATTAGAAATACAAGAAAAGCAGG - Intronic
945304106 2:208242256-208242278 AGTAGAAGTAGCAGAAACTCAGG + Intronic
945493129 2:210478954-210478976 GGAAGAAAGAGAAGGAAAGCAGG - Intronic
946152021 2:217781772-217781794 TGTAGAAGTAGGAGAAAAGTGGG + Intergenic
946342213 2:219077601-219077623 GGAATATGTAGAAGAACAGCTGG - Intronic
946577851 2:221095715-221095737 AGAAGAAGAAGAAAAAAAGCTGG - Intergenic
1170211277 20:13848487-13848509 GGAAGAAGAAGAAGAAGAGGAGG + Intergenic
1170247026 20:14232578-14232600 GGAAGCTGCAGAAGAAAAGCTGG - Intronic
1170940688 20:20845675-20845697 GGGAGAGGAAGAAGAAAAGGAGG + Intergenic
1171355813 20:24544694-24544716 GGTTGAAGAGGAAGAAAAGGAGG + Intronic
1171445653 20:25202240-25202262 GGCAGGAGTGGAAGAAAATCTGG + Intronic
1172152654 20:32801288-32801310 GGTAAAATTCGAAGAAGAGCCGG - Exonic
1172174484 20:32963841-32963863 GGAAGAAGGAGGAGAAAAGAAGG - Intergenic
1173351538 20:42249988-42250010 TGTAGATGTGGAAGAAAAGAAGG - Intronic
1173701921 20:45079889-45079911 GGTATAGGAAGAAGAAAAGAAGG - Exonic
1174573435 20:51520565-51520587 GGTAAAAAGAGAAGGAAAGCAGG + Intronic
1174641649 20:52049708-52049730 ATTAGAAGAAGAAGAAAAGGAGG - Intergenic
1174709049 20:52685869-52685891 GTTAGAAGTGGAAGAAAATTAGG + Intergenic
1174752953 20:53130045-53130067 GGCAGAAGAAGAAAAAAAGTAGG + Intronic
1174809904 20:53636796-53636818 GGAAGAAGAAGAAGAAAAAGAGG + Intergenic
1174809905 20:53636817-53636839 GGAAGAAGAAGAAGAAAAAGAGG + Intergenic
1174895158 20:54440902-54440924 GGTAGATGAAGAAAAACAGCAGG + Intergenic
1177593183 21:23200683-23200705 GGTAGAAATAGACAAAAAGATGG + Intergenic
1177618533 21:23556664-23556686 GGAAGAAGAAGAAGAAAAAGAGG + Intergenic
1177678499 21:24334458-24334480 TGGAGAAGTAGAAGAGAAGGAGG + Intergenic
1177809243 21:25907133-25907155 AGAAGAAGAAGAAGAAGAGCGGG - Intronic
1179675394 21:42977845-42977867 GGAAGATGCAGAAGAAAAGTTGG - Intronic
1179772082 21:43628482-43628504 GGAAGCTGCAGAAGAAAAGCTGG + Intronic
1179799370 21:43803746-43803768 CGGAGAAGAAGAAGAAACGCAGG + Exonic
1180678601 22:17606984-17607006 TGGAGAATTAGAAGAGAAGCGGG - Intronic
1181441859 22:22940821-22940843 GGAAGAAGAAGAAGAAGAGGAGG + Intergenic
1181881768 22:25986087-25986109 GGAACAATTAGAAGCAAAGCTGG + Intronic
1181973773 22:26713755-26713777 GGGAGATGAGGAAGAAAAGCAGG + Intergenic
1182171915 22:28239377-28239399 CGTACAAGAAGAAAAAAAGCTGG + Intronic
1183234065 22:36603283-36603305 GGAAGCTGCAGAAGAAAAGCTGG + Intronic
1183248432 22:36711416-36711438 GTGAGAAGCAGAAGCAAAGCAGG + Intergenic
1183601249 22:38841918-38841940 GGCAGAGGCAGGAGAAAAGCCGG - Intronic
1183787640 22:40039744-40039766 TGTAGAGGTAGGAGGAAAGCTGG + Exonic
1184284093 22:43457584-43457606 GGCAGTAATAGAAGAAAAGATGG - Intronic
1184449744 22:44575899-44575921 GGAAGAAGAGGAAGAAAAGAGGG + Intergenic
1185015660 22:48341156-48341178 GGGAGAAGCAGAAGGAATGCAGG + Intergenic
1185170915 22:49293592-49293614 GGAAGAAGTAGAAGAAGAGGAGG + Intergenic
1185286450 22:50002033-50002055 GGGAGAAGCAAAAGAACAGCAGG + Intronic
949484689 3:4526930-4526952 TATATAAGTAGAAGCAAAGCAGG + Intronic
949495725 3:4629874-4629896 GGTAGAAGAAGAAGAAACAATGG + Intronic
949580862 3:5386395-5386417 GGTAGAATCACAAGAAAAGTAGG - Intergenic
949809839 3:7994826-7994848 GGAAGCTGTAGAAGAAAAGTTGG + Intergenic
950112706 3:10429994-10430016 GGAAGATGCAGAAGAAAAGTTGG + Intronic
951374193 3:21892706-21892728 GGTAAAAGAAGTAGAAAAACTGG - Intronic
951530764 3:23696055-23696077 AGAAGAAGAAGAAGAAAGGCAGG + Intergenic
951845657 3:27081594-27081616 GGGAGTAGAAAAAGAAAAGCGGG - Intergenic
952460567 3:33521058-33521080 GTTAGAAGAACAACAAAAGCCGG + Intronic
952746153 3:36782644-36782666 GAAAGAAGTAAAAGAGAAGCTGG + Intergenic
952767672 3:36969070-36969092 GGTAGAAGTAGGAAAAGAGATGG + Intergenic
952838943 3:37628134-37628156 GGAAGAATGAGAAGAGAAGCTGG - Intronic
953068823 3:39499685-39499707 GGTCGAAGTAGATGAGAAGGAGG - Intronic
953270048 3:41432906-41432928 GGAAGTAGTAGAAGAAAATGTGG + Intronic
955117366 3:56018789-56018811 GTTAGCAAAAGAAGAAAAGCAGG + Intronic
955139478 3:56255155-56255177 GTTAGAGGTAGATGAAAAGATGG - Intronic
955318318 3:57957112-57957134 GGGAGAGGCAGAAGAAAAGAAGG - Intergenic
957262818 3:77922556-77922578 GGTATTAATAGAAGAAAAGAAGG + Intergenic
957578209 3:82036126-82036148 GGTGGAAGGTGAAGAAAAACAGG + Intergenic
958053950 3:88385442-88385464 GGAAGAAGTAGAAGAGTAGTTGG + Intergenic
958584102 3:96062881-96062903 GGAAGAAGAAGAAGAAAAAAAGG - Intergenic
958933119 3:100228926-100228948 GGAAGCTGCAGAAGAAAAGCTGG + Intergenic
959117399 3:102194498-102194520 GCTAGAAATAGATGAAAACCAGG + Intronic
959172287 3:102857954-102857976 GGAAGCAGAAGAAGAAGAGCAGG - Intergenic
959232746 3:103676897-103676919 GGCAGAAGCAGAATAAAACCAGG - Intergenic
959266448 3:104146369-104146391 GAAAGAAGTAGAATGAAAGCTGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959621482 3:108402931-108402953 GATGGAAGGAGAAGAAGAGCTGG - Intronic
959896068 3:111607848-111607870 GTTAAAAGTAGAAGAAAAAGAGG - Intronic
960144143 3:114181342-114181364 TGTGGAAATAGAAGAGAAGCAGG + Intronic
960185844 3:114637871-114637893 GGAAGAAGCAGAACATAAGCTGG - Intronic
960518007 3:118623497-118623519 GGTAGAAGGGAAAGAAATGCTGG + Intergenic
960867697 3:122218612-122218634 GGTAGAAGAAGAAGAAGATGAGG + Intronic
961292976 3:125862586-125862608 GCAAGAAGGAAAAGAAAAGCGGG - Intergenic
962029704 3:131586913-131586935 GATGGAACTAGAAGAAAACCTGG + Intronic
962977693 3:140459855-140459877 GGAGGATGTGGAAGAAAAGCAGG + Intronic
963202274 3:142597817-142597839 GGTATAAGTAGAAGAGAAAAAGG - Intronic
963476326 3:145809362-145809384 GGTAGAAGAATATGAAATGCTGG - Intergenic
963780409 3:149480819-149480841 TGTAGAAGTAGAATAAAAATAGG - Intronic
963800556 3:149671736-149671758 TGTAGAAGTAGAATAAAAATAGG - Intronic
963857062 3:150265779-150265801 GCTAGAAGTAGAAGAATACTAGG + Intergenic
963889447 3:150617523-150617545 GGTAAAAGTACAAGATAAACAGG - Intronic
964365841 3:155950067-155950089 GGTAGAATCAGAAATAAAGCAGG - Intergenic
964391982 3:156207238-156207260 GGTAGGAGAAGAAGAAAATGTGG + Intronic
964458201 3:156892145-156892167 GGGATAAGAAGAAGAAAGGCAGG + Intronic
964726696 3:159821060-159821082 GGTAAAAGTGGAAGAAATGGGGG + Intronic
965998730 3:174920462-174920484 GGAAGATACAGAAGAAAAGCTGG - Intronic
966128628 3:176609182-176609204 GGTAGAGGCAGAATCAAAGCGGG - Intergenic
966148851 3:176844020-176844042 GGAAGAAGAAGAAGAAAAGAAGG + Intergenic
966538833 3:181066228-181066250 AGAAGGAGTAGAAGAAAAGAAGG - Intergenic
966979466 3:185117765-185117787 GGGAGAAGGAAAAGACAAGCTGG - Intronic
967322642 3:188209722-188209744 GGTGGAGGTAGATGAACAGCTGG + Intronic
967881313 3:194303775-194303797 GCCAGAAGGAGAAGGAAAGCAGG + Intergenic
968635257 4:1675178-1675200 GGTAGATGTAGAAGAGACGTGGG + Intronic
969004300 4:4006895-4006917 GCAAGAAGGAAAAGAAAAGCGGG + Intergenic
969378754 4:6780818-6780840 GGTAGAACTAGTATAAAAACTGG + Intergenic
969383808 4:6828758-6828780 AGTAGAAGATGAAGAAAAGTGGG - Intronic
969809600 4:9637819-9637841 GCAAGAAGGAAAAGAAAAGCGGG - Intergenic
970028193 4:11646924-11646946 GTTAGAAGAAGAAGAAGAGGAGG + Intergenic
970278670 4:14429783-14429805 GGTAGGAGATGAAGAAAGGCAGG + Intergenic
970577249 4:17439379-17439401 GGTAGAAGGAGAAGGGGAGCTGG + Intergenic
970801539 4:19978424-19978446 GGTAGAGATAGAAGCTAAGCAGG + Intergenic
970847402 4:20557044-20557066 GGAAGCTGTAGAAGAAAAGTTGG + Intronic
971516589 4:27494614-27494636 GGAAGAAGGAGAAGAAGAGGAGG + Intergenic
971617253 4:28807732-28807754 GGTAGAAAGAGAAAAAAAGTCGG + Intergenic
972200894 4:36713671-36713693 AGAAGAAGAAGAAGAACAGCAGG - Intergenic
973088230 4:46096374-46096396 GGTAAAACTAGAACAAAAACAGG + Intronic
973276504 4:48315425-48315447 GGTAGAAGGTGAAGGAAACCTGG - Intergenic
974646457 4:64699932-64699954 GGTAAAAGAAAAAGAAAACCTGG + Intergenic
975040302 4:69738397-69738419 GGCAGAAGCAAAAGAGAAGCAGG + Intronic
975940525 4:79639101-79639123 GGTAGGAGGAAAAGTAAAGCAGG - Intergenic
976734771 4:88298360-88298382 GGTAGAATCAGAAGAAGAGCTGG - Intergenic
976907302 4:90255038-90255060 GGTAGAAGCAGAATAAATGCTGG - Intronic
977160988 4:93634907-93634929 GGAAGAAGTAGGAGAAAAGAGGG - Intronic
977367519 4:96089709-96089731 GGTATAAGCAAAAGAACAGCAGG - Intergenic
977377050 4:96218926-96218948 GTTAGAAGTAACAGAAAGGCAGG - Intergenic
978318366 4:107465319-107465341 GGTGGAAGTTGAAGCAGAGCAGG - Intergenic
978386448 4:108180316-108180338 GAAAGAAGGAGAAGAAAAGAAGG + Intergenic
978386513 4:108180867-108180889 GGAAGAAGGAGAAGAAAACGAGG + Intergenic
979409053 4:120351905-120351927 GGTAGAGGTAGCAGAAAAAAAGG - Intergenic
980910773 4:138992441-138992463 GAAAGAAGAAGAAGAAAAGAAGG + Intergenic
981094552 4:140764855-140764877 GATAGAAGCAAAAGAACAGCAGG + Intergenic
982449214 4:155532139-155532161 AGTAGAAGTGGAAGAAAGGCAGG - Intergenic
982453542 4:155580267-155580289 GGAAGCTGTAGAAGAAAAGCTGG + Intergenic
982844093 4:160227488-160227510 TGAAGAAGGAGAAGAAAAGAGGG + Intergenic
982976267 4:162066293-162066315 AGAAGAAGAAGAAGAAAAGTAGG - Intronic
983092238 4:163517558-163517580 GGTAGAACTAAAAGAAAATCGGG + Intronic
983201435 4:164864397-164864419 GGAAGAAGAAGAAGAAGAGGAGG + Intergenic
983636580 4:169903294-169903316 GATAGAAAGAGAAGAAAAGAGGG - Intergenic
983708259 4:170684838-170684860 AGAAGAAGAAGAAGAAAAGGGGG + Intergenic
983758229 4:171369433-171369455 GGAAGCTGTAGAAGAAAAGTTGG + Intergenic
983762670 4:171431750-171431772 TGAAGAAGTAGAAAAAAAACAGG + Intergenic
983875835 4:172873578-172873600 GGTAGAAGTAGAACACAACAAGG + Intronic
983912876 4:173259479-173259501 GGTAGAACTAGAGAAATAGCAGG - Intronic
985797674 5:1975294-1975316 GGTAGAGGAAGAAGAGGAGCTGG + Intergenic
986009701 5:3700983-3701005 GGAAGAAGAAGAAGAAAAGAAGG - Intergenic
986187803 5:5461217-5461239 GGTAGAAGAGGAAGAAAAACTGG - Exonic
987124532 5:14799211-14799233 GGAAGTTGCAGAAGAAAAGCTGG + Intronic
987977555 5:25033792-25033814 GGCAGAAGCAGAAGGAAAGTAGG - Intergenic
988125659 5:27030500-27030522 AATAGAAGTAGCAGAGAAGCAGG + Intronic
988433890 5:31150664-31150686 GCTACAAGTAGAAGAAAATGAGG - Intergenic
989256362 5:39369797-39369819 GGTGGAAGGAAAAGAAAAGGGGG - Intronic
989623890 5:43411474-43411496 GAAAGAAAAAGAAGAAAAGCAGG - Intronic
989672050 5:43929816-43929838 GGTGGAAGTAGAAGGGAAGAGGG - Intergenic
991330372 5:65486573-65486595 CGAAGAAGGAAAAGAAAAGCTGG - Intergenic
991618325 5:68519141-68519163 GCTACAAGTAGAAGAAACTCTGG - Intergenic
992686930 5:79208280-79208302 GGAAGAAGGAGAAGAGAAGGTGG + Intronic
992905581 5:81342410-81342432 GGTAGATGGAGAAGAGAAGGAGG + Intronic
992957532 5:81925471-81925493 GGAGGCAGTAAAAGAAAAGCTGG - Intergenic
993174156 5:84460744-84460766 GGTAGAAAGAGAAGAGGAGCTGG + Intergenic
993936332 5:94008229-94008251 GGTAGAAGTATATGAGAAACAGG + Intronic
995022204 5:107379734-107379756 GGCAGAAGGAGAATAAATGCAGG - Exonic
995222268 5:109662957-109662979 GGCAAATGTAGAAGAAAGGCTGG - Intergenic
995519659 5:112989945-112989967 AGGAGAAGTAGAAGAAAGGATGG + Intronic
995562035 5:113392460-113392482 GGTATTGGTGGAAGAAAAGCTGG + Intronic
995619292 5:114005968-114005990 GAAAGAAGTAGAAGAAATACAGG - Intergenic
996512479 5:124332361-124332383 GGAAGTTGTAGACGAAAAGCTGG - Intergenic
996693527 5:126367466-126367488 GGAGGAAGTAGAGGAAAAGGAGG + Intronic
996824702 5:127668925-127668947 GGTAGAACTGGAAAAGAAGCTGG - Intergenic
997652341 5:135531800-135531822 GGTGGGAGTAGGAGAAGAGCAGG - Intergenic
997709695 5:135993542-135993564 AGAAGAAGCAGAAGAAAATCTGG + Intergenic
997998762 5:138607571-138607593 GGTTGAAGCAGAAGAATTGCTGG - Intergenic
998452077 5:142242472-142242494 GGTGGAAGTTGAAGAGGAGCTGG - Intergenic
998587504 5:143442858-143442880 GGGAGAAATAGGAGAAAATCTGG + Intergenic
998680775 5:144464704-144464726 GGAAGAAGAAGAAGAAGAGGAGG - Intronic
999272982 5:150308419-150308441 GGAAGAAGAAGAAGAAGAGGAGG + Intronic
1000265420 5:159631733-159631755 GGTAGAAGGTGAAGGAAAGCAGG + Intergenic
1000691880 5:164333327-164333349 GGATGAAGTAGAAGAAAAAGTGG + Intergenic
1001040269 5:168329689-168329711 GGCAGCAGAAGAAGCAAAGCAGG - Intronic
1001344693 5:170882699-170882721 GGTATATGTAAAATAAAAGCAGG + Intronic
1001466889 5:171975343-171975365 GGTAGATTGAGAAGAAAAGGGGG - Intronic
1001519176 5:172378508-172378530 AGTTAAAGTAGAAGAAAATCTGG + Intronic
1003516570 6:6823515-6823537 GGAAGAAGAAGAAGAAAAGGAGG + Intergenic
1004129921 6:12909882-12909904 GTTAGAAGTTGAAGAATAGTGGG - Intronic
1004267154 6:14158743-14158765 GGCAGAAGGAGAAGAGGAGCAGG - Intergenic
1005695432 6:28347461-28347483 GGAAGAAAAAGAAGAAAATCAGG - Intronic
1007065553 6:38987295-38987317 AGTAGAAGAGGAAGAAAGGCAGG - Intronic
1007158097 6:39765720-39765742 GGTAGAAGAAGAACTAAAACAGG - Intergenic
1007424226 6:41736301-41736323 AGGGGAAGGAGAAGAAAAGCAGG - Intergenic
1007464313 6:42041342-42041364 GGTAGAATTCAAAGAAAAGATGG + Intronic
1007718110 6:43869165-43869187 GACAGAAGGAGAAGAAAGGCTGG - Intergenic
1007999935 6:46349803-46349825 ATTAGAACTAGAAGAGAAGCTGG - Intronic
1008425838 6:51355162-51355184 TCTAGAAGTAGCAGTAAAGCTGG - Intergenic
1008687502 6:53941790-53941812 AGTAGAAGCAGATGAAAAGTTGG - Intronic
1009006229 6:57791941-57791963 GGAAGAAGAAGAAGAAGAACAGG + Intergenic
1009411619 6:63371631-63371653 GGTAAATGTAGAAAAAAAGTTGG - Intergenic
1009844413 6:69117960-69117982 GGTAGAAGAGGCAGAAAAACAGG - Intronic
1010905118 6:81477719-81477741 GGTAGAAGGAGGAGAGAAACTGG + Intergenic
1011084510 6:83524129-83524151 GGGAGAAGAAGAAAAAAATCTGG + Exonic
1011354639 6:86461533-86461555 AGTAGAAGAAGAAGAAGAGGAGG + Intergenic
1011354655 6:86461665-86461687 AGAAGAAGAAGAAGAAAAGAAGG + Intergenic
1011720737 6:90154212-90154234 GCCAGAAGTAGAGGAAATGCAGG + Intronic
1012116648 6:95307582-95307604 TGTAGAAGTAAATAAAAAGCAGG + Intergenic
1012301651 6:97596203-97596225 GGTAAAAGTACAAAAAAAGCAGG + Intergenic
1012713187 6:102634391-102634413 GGAAGAAGAAGGAGAAAATCTGG + Intergenic
1013098137 6:106964602-106964624 GGTGGAGGGAGAAGAAAGGCAGG + Intergenic
1013895048 6:115077826-115077848 GGTATTTGTTGAAGAAAAGCAGG - Intergenic
1013984003 6:116167624-116167646 GGTAGAAGGGTAAGAAAAGAAGG - Intronic
1014516536 6:122385558-122385580 GGTAGATGTGGAAGAATAGCTGG + Intergenic
1015047956 6:128800821-128800843 GGAAGAGGAAGAAGAGAAGCAGG - Intergenic
1015178015 6:130332279-130332301 GGTAAGATTAGAAGGAAAGCAGG + Intronic
1015324329 6:131907420-131907442 GTTAGGGGTAGAAGAAAAGATGG + Intergenic
1015444556 6:133288026-133288048 GGCTGAAGTAGAAGAATCGCTGG + Intronic
1016154397 6:140785905-140785927 GGAACAAGTAGTAGAAAAGCAGG - Intergenic
1016264923 6:142221442-142221464 GGTAAAAGCAGGAGAAAGGCTGG + Exonic
1016340208 6:143054064-143054086 GGAAGAAGAAGAAGAAGAGGAGG - Intergenic
1016601377 6:145865351-145865373 CATAGAAGTAGATGAAAAGATGG + Intronic
1016903310 6:149123627-149123649 GGAAGTTGTAGAAGAAAAGTTGG + Intergenic
1017199893 6:151741208-151741230 GGAGGAAGAAGAAAAAAAGCAGG - Intronic
1017587354 6:155941725-155941747 GGTAGTAGGAGTAGAAAAACTGG - Intergenic
1017602120 6:156094970-156094992 AATAGAATTAGAAGAAAATCAGG + Intergenic
1017752682 6:157503033-157503055 GGTTGAAGTAGCAGAAAGCCAGG + Intronic
1018891231 6:167984549-167984571 GGCATAAGCAGAAGAACAGCAGG - Intergenic
1020202613 7:6092096-6092118 GGAAGAAGAAGAAGAAGAGGAGG - Intergenic
1020377494 7:7504514-7504536 AGAAGAAGAAGAAGAAAAGGAGG + Intronic
1020713739 7:11642234-11642256 GGTAGGGGTAGCAGAAAATCTGG + Intronic
1021246757 7:18272992-18273014 GGAAGAAGAAGAAGAAGAGGAGG - Intronic
1021289516 7:18825355-18825377 GGGAAAAGTAGAGGAAAACCAGG + Intronic
1021697007 7:23285694-23285716 GGTAGAAGCAAAAGACCAGCAGG + Intergenic
1022992464 7:35721879-35721901 GGGGGAAGAGGAAGAAAAGCTGG - Intergenic
1023693449 7:42818742-42818764 GGAAGAAGGAGAAGAAAAAGAGG + Intergenic
1024028662 7:45436410-45436432 GGTAGAAGAGGAGGAAAAGATGG + Intergenic
1024287468 7:47771788-47771810 GGGAGAAGAATGAGAAAAGCAGG - Intronic
1024957735 7:54942487-54942509 GGAAGAAGAAGAAGGAAAGAAGG + Intergenic
1025938475 7:66056362-66056384 GGAAGTTGTAGAAGAAAAGTTGG + Intergenic
1025945975 7:66104851-66104873 GGAAGCTGTAGAAGAAAAGGTGG - Intronic
1026134319 7:67646069-67646091 GGTACAAGCAAAAGAATAGCAGG - Intergenic
1026415376 7:70174307-70174329 GGAAGCTGCAGAAGAAAAGCTGG + Intronic
1026972275 7:74475696-74475718 GGCAGAAGTGGAAGTAATGCAGG + Intronic
1027703501 7:81499430-81499452 AGTAGAAATATAAGAAAAGAGGG - Intergenic
1028170915 7:87594697-87594719 CGTAGAGATAGAATAAAAGCAGG + Intronic
1028403456 7:90449374-90449396 TGTAAAACTAGAAGAAAAGATGG - Intronic
1029013640 7:97290548-97290570 GGAAGAAGAAGAAGAAAAGGAGG + Intergenic
1029915321 7:104203051-104203073 AGTATAAGTAGAAGAAAACCTGG + Intronic
1029960032 7:104680792-104680814 GGTAAAAGAAGAAGAAAAGAAGG + Intronic
1031313691 7:120231184-120231206 GGTTGAAGTAGAAGACAAGAAGG + Intergenic
1031339200 7:120578101-120578123 GGAAGAGGAAGAAGAAAAGAAGG + Intronic
1031495392 7:122441144-122441166 GGTAGAAGTACAAATAAAGTTGG + Intronic
1032513705 7:132491871-132491893 GGGAGGAGTAGAAGAAAGGAAGG + Intronic
1032847123 7:135761063-135761085 GACAGAAGTAGAAAAAAACCTGG + Intergenic
1033621173 7:143063119-143063141 GGGAGAAGTAAAAGAAAGACTGG + Intergenic
1033662100 7:143409112-143409134 GGTAGAATTAGGTTAAAAGCTGG - Intergenic
1034166880 7:149032029-149032051 AGGAGAATTTGAAGAAAAGCAGG + Intergenic
1034316833 7:150141088-150141110 GGAAGCTGCAGAAGAAAAGCTGG + Intergenic
1034645278 7:152640799-152640821 GCTAAAATTAGAAGAAAAGCAGG - Intergenic
1034790029 7:153959596-153959618 GGAAGCTGCAGAAGAAAAGCTGG - Intronic
1035012078 7:155728149-155728171 GGTAGCAGGATAAGAAAAGAGGG - Intronic
1036443330 8:8800649-8800671 AGTAGAACTTGAAGATAAGCAGG - Intronic
1036587553 8:10138364-10138386 GGGAGAAGGAGAAGAAAGGGAGG + Intronic
1036735661 8:11313205-11313227 GGAAGCTGTAGAAGAAAAGTTGG - Intronic
1036957421 8:13203510-13203532 GGAAGAAGTTGAAGAAAACCTGG + Intronic
1037089823 8:14899852-14899874 GGAAGAAGAAGAAGAAGAGGAGG + Intronic
1037283059 8:17265203-17265225 GGAGGAAGTAGAAGGAAGGCAGG + Intronic
1037387177 8:18355545-18355567 GGTAGAAAGGGAAGAAAAGGGGG - Intergenic
1038456922 8:27679117-27679139 GGAGGAAGAAGAAGAAAAACAGG - Intergenic
1039033665 8:33335922-33335944 GGTAGAAGCAGAAGAGATGGAGG + Intergenic
1039382004 8:37094300-37094322 GGAAGCTGCAGAAGAAAAGCTGG + Intergenic
1039410008 8:37345834-37345856 GGCAGAAGTAAAATGAAAGCAGG + Intergenic
1039661584 8:39472977-39472999 GGAAGAAGTAGTAGGAGAGCAGG + Intergenic
1039806186 8:41001716-41001738 GGAAGAAGGAGAAGAAGAGGAGG - Intergenic
1039830359 8:41208705-41208727 GGTAGAAGGAAAAGAGGAGCTGG + Intergenic
1040453635 8:47574409-47574431 TGTAGAAGCAGAAGTAAAACTGG - Intronic
1040636562 8:49281234-49281256 GGCAGAGGCAGAAGAAAATCTGG + Intergenic
1041401390 8:57448836-57448858 GGAAGAAGAAGAAGAAGAGGAGG - Intergenic
1041455848 8:58058419-58058441 GGGACAAGTAAAAGAAAAACTGG + Intronic
1041464327 8:58143800-58143822 GATAGAACTAGAAGAGAAGATGG + Intronic
1041710820 8:60892684-60892706 TGGAGAGGTAGAGGAAAAGCAGG + Intergenic
1042036493 8:64539895-64539917 GGAAGAATAAAAAGAAAAGCAGG + Intergenic
1042929606 8:74000250-74000272 GGTAGAAGAAATAGATAAGCAGG - Intronic
1043255877 8:78135934-78135956 GGTAGGAGGAGAAGAAGAACAGG + Intergenic
1043355442 8:79406242-79406264 GGAAGAGGTAAAAGAAAATCAGG + Intergenic
1043386424 8:79752530-79752552 GGAAGAAGAAGAAGAAGAACAGG + Intergenic
1043428782 8:80174347-80174369 GGAAGATGTAAGAGAAAAGCAGG - Intronic
1043560834 8:81491407-81491429 AGAAGAAGAAGAAGAAAACCTGG - Intergenic
1043626558 8:82268051-82268073 ATTTGAAGTACAAGAAAAGCAGG - Intergenic
1043981193 8:86641544-86641566 GGGAGAAGTACAGGAAAGGCAGG - Intronic
1044373682 8:91444807-91444829 GGTAGAAGTCAATGGAAAGCAGG - Intergenic
1044391919 8:91661738-91661760 GGCAGCAGTAGAAGACAAGGTGG + Intergenic
1044976961 8:97674234-97674256 GGAAGAAGTAGGAGAATTGCAGG - Intronic
1045117153 8:98995152-98995174 GAGAGAAGGAGAAGAAAAGCCGG - Intergenic
1046127936 8:109933944-109933966 GGTAGCAAAGGAAGAAAAGCTGG - Intergenic
1046250734 8:111627422-111627444 GGTAGAAGAAGAAAAAAAAGTGG - Intergenic
1046281644 8:112041033-112041055 TGGAGAAGTAGAAGAAATGGAGG + Intergenic
1047439588 8:124865474-124865496 GGAAGAAGAAGAAGAAGAGGAGG - Intergenic
1048400984 8:134070422-134070444 GGAAGAAGTAGAAGAAAAGAAGG - Intergenic
1048516591 8:135116843-135116865 GGAAGAAGAAGAAGAAGAGGAGG - Intergenic
1050114095 9:2245097-2245119 GGTAGATGTAGCAGGAGAGCTGG + Intergenic
1050494921 9:6230562-6230584 GGCAGAAGTGGAGGAGAAGCGGG - Intronic
1050814752 9:9796200-9796222 GAAAGAAGAAGAAGAAAAGGAGG + Intronic
1050971280 9:11878867-11878889 AGTAGAAGAAGGAGAAAAGGGGG + Intergenic
1051880649 9:21836428-21836450 GGCAGAGGTAGATGAAATGCGGG + Intronic
1052209313 9:25882885-25882907 GGGAGAAGTAGGTCAAAAGCTGG - Intergenic
1052712401 9:32072527-32072549 AGTAGCAGGAGAAGGAAAGCTGG + Intergenic
1052999841 9:34571870-34571892 GGAAGAAATAGAAGAGACGCAGG + Intronic
1053727416 9:41017982-41018004 GGTAGAAGGTGAAGGAGAGCTGG + Intergenic
1054701098 9:68414130-68414152 GGTAGAAGGTGAAGGAGAGCTGG - Intronic
1054799419 9:69332228-69332250 GGGAGAAGTTGAATAAAAGTAGG + Intronic
1054950712 9:70848383-70848405 GGTAGAAGTAAAAGAGATGATGG + Intronic
1055460189 9:76512110-76512132 GGGAGAAGCAGGAGAAGAGCAGG + Intergenic
1055723128 9:79197928-79197950 GGAAGAAGAAGAAGAAAAACAGG - Intergenic
1056239809 9:84633506-84633528 AGGAGAAGCAGAAGAAAACCAGG + Intergenic
1057158668 9:92868632-92868654 GGCAGAAGGGGAAGAGAAGCCGG + Intronic
1057253959 9:93527925-93527947 GGTAGAAGTAGAAGAAAAGCAGG - Intronic
1057966634 9:99510438-99510460 GCTCCAAGTAGAACAAAAGCTGG + Intergenic
1058789311 9:108425705-108425727 GGAAGAGGCAGAAGGAAAGCTGG - Intergenic
1058883441 9:109305180-109305202 GGGAGAAGTGGAAGAAGCGCGGG + Intronic
1058955279 9:109941118-109941140 GGAAGAAGAAGAAGAAGAGAAGG - Intronic
1059524831 9:114980991-114981013 TGTAGAAATTGAAGAAAGGCGGG + Intergenic
1059650997 9:116315753-116315775 GGTAGAGGTAAAAGGAAAGAAGG + Intronic
1059683051 9:116605091-116605113 GGTAGAAAAAGAAGAAAAGAAGG + Intronic
1059918024 9:119125456-119125478 GGTAGAGGAAGAAAAAAGGCAGG - Intergenic
1060198139 9:121636317-121636339 GCTAAAAGGAGAATAAAAGCAGG - Intronic
1060767433 9:126305403-126305425 TCTAGAAGTGGAATAAAAGCAGG + Intergenic
1060975357 9:127762006-127762028 GACAGAAGAAGAAGAAAACCAGG - Intronic
1202629560 M:5327-5349 GGTAGAAGTAGAGGTTAAGGAGG - Intergenic
1203426968 Un_GL000195v1:50043-50065 GGTAGAGATAGAAGAAATGTTGG + Intergenic
1186064093 X:5742912-5742934 GGAAGAAGAAGAAGAAGAGGAGG + Intergenic
1186093558 X:6075749-6075771 GGTGGAAGGTGAAGAAGAGCTGG - Intronic
1186395334 X:9202638-9202660 GGAAGCTGCAGAAGAAAAGCTGG + Intergenic
1186646160 X:11509307-11509329 GGTGGAAGTAGAAAAGAAGGGGG + Intronic
1186933231 X:14417980-14418002 AATGGAAGTAGAAGAAAAGCAGG + Intergenic
1187601833 X:20839755-20839777 GGTTGAAGAAGAAGAAAGCCGGG - Intergenic
1188340653 X:28997121-28997143 GGAAGAAGTTGTACAAAAGCAGG + Intronic
1188681814 X:33017547-33017569 TGTAGAAACAGAAGAAAAACTGG - Intronic
1189140330 X:38598446-38598468 GGTAGAAGAAGAAGAAAAAAAGG - Intronic
1189560055 X:42183197-42183219 GGTAGAAGATGAAGGGAAGCTGG + Intergenic
1190442384 X:50487831-50487853 GATAGCACTTGAAGAAAAGCTGG + Intergenic
1190460095 X:50664200-50664222 TGTAGAAGTAGTAGAAATACTGG - Intronic
1190473388 X:50805227-50805249 GGTAGAGCTAGAAGTAAAGCTGG - Intronic
1190628633 X:52363293-52363315 TTTTGAAGTAGAAGAAACGCAGG + Intergenic
1190699846 X:52979520-52979542 GGGAGAAGGAGAAGGACAGCTGG - Intronic
1190704983 X:53019958-53019980 GGAAGAGGAAGAAGAAAAGGAGG + Intergenic
1190915156 X:54806195-54806217 GCCAGAAGTAGAAGAAAAGGAGG + Intergenic
1191007939 X:55730508-55730530 GGTAGTAGGAGAAAAAAATCAGG - Intronic
1191730251 X:64326183-64326205 GGAAGAGGAAGAAGAAAAGTTGG + Intronic
1192329763 X:70165861-70165883 GGAAGAACAAGAAGAAAAGGAGG + Exonic
1192341403 X:70266673-70266695 AGTAGAAAGAGAAGATAAGCGGG + Intergenic
1193451148 X:81669582-81669604 GCTGGAAGTAGAAGAGAAGAGGG - Intergenic
1194318482 X:92412000-92412022 GGAAGAAGAAGAAGAAGAGGAGG + Intronic
1195433015 X:104810506-104810528 GATAGAAGGAAAAGAAAATCTGG - Intronic
1196351452 X:114735812-114735834 GGAAGAAATAGAAGAAAATAAGG + Intronic
1196384496 X:115134190-115134212 GGAAGCTGCAGAAGAAAAGCTGG + Intronic
1196428619 X:115598377-115598399 GGTTGAAGCAGAAGAAAAAGTGG - Intronic
1196866997 X:120078976-120078998 GGCAGGAGTAGAGGAAAAGAGGG - Intergenic
1196876102 X:120157306-120157328 GGCAGGAGTAGAGGAAAAGAGGG + Intergenic
1197656159 X:129118063-129118085 GGTAGTAGCAGAAGAGAATCTGG + Intergenic
1199534687 X:148889263-148889285 GGTAGAAGTAGCAGAAAAAGGGG - Intronic
1199751582 X:150824289-150824311 GGAAGAAGAAGAAGAAGAGGAGG + Intronic
1200417746 Y:2930636-2930658 TGAAGAAGTAGAAAAAGAGCAGG - Intronic
1201331796 Y:12831465-12831487 GTTAAAAGTAGAAGTACAGCCGG + Intronic
1201454681 Y:14157007-14157029 GGGAGAAGTAAAGGAAAACCTGG + Intergenic
1202302308 Y:23429678-23429700 GGTAAAAGTAGAGGAGAAACTGG - Intergenic
1202568503 Y:26240920-26240942 GGTAAAAGTAGAGGAGAAACTGG + Intergenic