ID: 1057256317

View in Genome Browser
Species Human (GRCh38)
Location 9:93550574-93550596
Sequence CAGGTACATGGTGCAGTGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057256308_1057256317 2 Left 1057256308 9:93550549-93550571 CCAACCTTTTGTTTCTGCCCCTC 0: 1
1: 0
2: 3
3: 30
4: 456
Right 1057256317 9:93550574-93550596 CAGGTACATGGTGCAGTGGCCGG 0: 1
1: 0
2: 0
3: 20
4: 227
1057256309_1057256317 -2 Left 1057256309 9:93550553-93550575 CCTTTTGTTTCTGCCCCTCACCA 0: 1
1: 0
2: 5
3: 32
4: 389
Right 1057256317 9:93550574-93550596 CAGGTACATGGTGCAGTGGCCGG 0: 1
1: 0
2: 0
3: 20
4: 227
1057256307_1057256317 16 Left 1057256307 9:93550535-93550557 CCACTCAGTAATCACCAACCTTT 0: 1
1: 0
2: 1
3: 15
4: 124
Right 1057256317 9:93550574-93550596 CAGGTACATGGTGCAGTGGCCGG 0: 1
1: 0
2: 0
3: 20
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057256317 Original CRISPR CAGGTACATGGTGCAGTGGC CGG Exonic
901738816 1:11329105-11329127 CAGCTACCTGGTTCATTGGCTGG + Intergenic
902079186 1:13809500-13809522 CAGGAGCAGGGTGGAGTGGCAGG + Intronic
902134839 1:14296241-14296263 CAGGCAAATGCTGCAGTGGTGGG + Intergenic
902692981 1:18121840-18121862 CGGGTACATGGAACAGGGGCTGG - Intronic
903028024 1:20443332-20443354 CAGGCAGATGGGGCAGTGGTCGG + Intergenic
903061435 1:20671471-20671493 CAGGTACATGCTGCCATGCCTGG + Intronic
903961655 1:27061617-27061639 CAGGCAAATGCTACAGTGGCTGG + Intergenic
904113352 1:28143815-28143837 CAGCCACATGGTGGAGTGGGAGG + Intergenic
904462489 1:30688503-30688525 CAGGTACATGGTGTGGGGGTTGG - Intergenic
904602499 1:31681268-31681290 CGGGTACTTGGCCCAGTGGCTGG - Intronic
906318791 1:44804260-44804282 CTGGTACATGCTGCTGTGGTGGG + Intronic
907821213 1:57971443-57971465 AAGGTACATGGTGTAGTGTGAGG + Intronic
908182274 1:61617540-61617562 CTGGTACATAGTACAGTGACTGG + Intergenic
908752675 1:67439616-67439638 GAGGTACATGGGGCAGTGGTAGG - Intergenic
908848958 1:68354574-68354596 CAGGTCCATGATGCTGTGTCTGG + Intergenic
910920859 1:92345221-92345243 CAGGTACATGCTGCTGTGTCTGG - Intronic
912455277 1:109792691-109792713 GGGGTGCATGGGGCAGTGGCGGG + Intergenic
913059871 1:115194974-115194996 TAGGTCCTCGGTGCAGTGGCTGG + Intergenic
913333205 1:117684296-117684318 CATGTCCATGGTTCTGTGGCTGG + Intergenic
914004912 1:143724027-143724049 CAGGGACAAGGTGTAGGGGCAGG + Intergenic
915152768 1:153848172-153848194 CAGGGACATGGGGCAGTGACTGG - Intronic
918143578 1:181737536-181737558 CAGGTTCACGATGTAGTGGCAGG - Exonic
918368807 1:183838025-183838047 CTGGTCCATGGTGCAGGGGTTGG + Intronic
918617497 1:186562940-186562962 GAAGTAGATGGTGCAGAGGCAGG + Intergenic
918647891 1:186923010-186923032 CAGGTCCAGGGTGTAGTGCCAGG + Intronic
923121188 1:230993231-230993253 CAGGTACATGCTACTGTGCCTGG + Intronic
1063511839 10:6653021-6653043 CAGGCACATGCTGCAATGCCTGG + Intergenic
1065320003 10:24500441-24500463 CAGGTACCTGGAGTAGAGGCTGG - Intronic
1067090059 10:43261957-43261979 GAAGTACCTGGTGCTGTGGCTGG + Intronic
1067345215 10:45433325-45433347 CAGGTGCATGTTGCAGTGGGCGG + Intronic
1069878031 10:71574956-71574978 GAGTCACATGGTGCAGTGGGGGG - Intronic
1071116474 10:82227147-82227169 CAAGTACAAGCTGCAGTGGGTGG - Intronic
1072745646 10:97937372-97937394 CAGGGTGGTGGTGCAGTGGCGGG - Intronic
1073320774 10:102615088-102615110 GAAGTGCTTGGTGCAGTGGCTGG + Intronic
1074721975 10:116272021-116272043 CAGGAACATGGTGCCGGCGCGGG + Exonic
1074916539 10:117961490-117961512 CAGCTACCTGGGGCAGTTGCTGG + Intergenic
1074992164 10:118718685-118718707 CAGGTACTTGGGGCTGAGGCAGG - Intronic
1075816065 10:125265570-125265592 CAGGCAAATGATGCAGTGTCCGG + Intergenic
1076590265 10:131577913-131577935 CAGATAAATGGGGCAGGGGCTGG + Intergenic
1076855502 10:133113832-133113854 CAGGGACATGGGGAAGGGGCGGG - Intronic
1077607779 11:3623609-3623631 CAGGCACATGCTGCCGTGCCTGG - Intergenic
1078026335 11:7699133-7699155 CAAGTGTATGGTACAGTGGCAGG - Intronic
1078655695 11:13236797-13236819 AAGGAACATGGTACAGTGACTGG + Intergenic
1081654388 11:44847974-44847996 CAGGTACATGCCACTGTGGCTGG + Intronic
1083080902 11:60092436-60092458 CAGGTGCATGCCACAGTGGCTGG + Intronic
1083673675 11:64314023-64314045 CAGGCACTTGGTGAAGCGGCAGG - Exonic
1084375054 11:68771019-68771041 CAAGTACATGGCACAGTGGCTGG + Intronic
1084750212 11:71199641-71199663 CAGGTCCTAGGGGCAGTGGCCGG - Intronic
1084802957 11:71557397-71557419 GAGGTACATAGGACAGTGGCTGG - Intronic
1084931507 11:72560171-72560193 CAGATAAATGGTTCAGAGGCAGG + Intergenic
1086642417 11:89176085-89176107 CAGGTACATGGAGCAGTGTGTGG - Intergenic
1087742538 11:101905339-101905361 TTGGTACAGGGTGGAGTGGCTGG - Intronic
1088059339 11:105627300-105627322 CAGGTAGGTGGTGGAGTGGAGGG + Intronic
1088992915 11:114970204-114970226 GAGGTATGTGGTGCAGTGACCGG + Intergenic
1089562574 11:119351727-119351749 CAGGTGCATGGTGCTATGTCTGG + Intergenic
1089736055 11:120550877-120550899 CAGGTGCACAGAGCAGTGGCTGG + Intronic
1090187545 11:124748189-124748211 GCGGTACAGGGTGGAGTGGCTGG - Intronic
1100228728 12:92585714-92585736 CAGGTACATGGTGCTATGAGAGG - Intergenic
1101775532 12:107789761-107789783 CAAGCACCTGTTGCAGTGGCTGG - Intergenic
1102062719 12:109945989-109946011 CAGGCACATGGTCCTGTGCCTGG - Intronic
1103707087 12:122881597-122881619 CAGGTGCATGCTGCCATGGCTGG - Intronic
1105535506 13:21260733-21260755 CAGGCACTTGGTGAAGCGGCAGG - Intergenic
1107396097 13:40019069-40019091 GAGAGACATGGGGCAGTGGCTGG + Intergenic
1110711243 13:78653326-78653348 CAGGGACATGGGGCAGTGTGTGG - Intronic
1114337010 14:21700313-21700335 CTGGTACTTGGGGCAGGGGCAGG - Intergenic
1115570950 14:34665633-34665655 GAGGTAGAGGTTGCAGTGGCTGG + Intergenic
1115973358 14:38970310-38970332 CAGGAAAATGGAGCAGTCGCTGG + Intergenic
1115989977 14:39141415-39141437 CAGGTGCATGGTGCAATGGTAGG + Intergenic
1117702401 14:58426931-58426953 CACGTACCTGGAGCAGTGGGGGG - Intronic
1119451900 14:74718985-74719007 CAGGCACATGGTGCTGCGCCTGG - Intronic
1119504430 14:75159935-75159957 AAGGTGCAGGCTGCAGTGGCGGG - Intronic
1119826782 14:77663432-77663454 CAAGTACAAGGTGTAGTGGGAGG - Intergenic
1120782313 14:88495946-88495968 CAGAGATATGGTGCAGAGGCTGG + Intronic
1121230817 14:92356637-92356659 AAGTCACATGGCGCAGTGGCTGG + Intronic
1127148169 15:56047354-56047376 AAAGTACAAGGTGAAGTGGCAGG - Intergenic
1127489448 15:59448304-59448326 GAGGTAGATGTTGCAGTGGGTGG + Intronic
1129524622 15:76205901-76205923 CAGGGACATGGTGCACTGTCAGG - Intronic
1129550880 15:76447896-76447918 CAGGTGCAAAGTGCAGTGCCTGG + Intronic
1129788221 15:78323079-78323101 CAGGACAATGCTGCAGTGGCTGG - Intergenic
1132770462 16:1559405-1559427 CAGTCACACGGTGCAGAGGCAGG + Intronic
1137869791 16:51938957-51938979 AAGGTAGAAGGTGGAGTGGCCGG - Intergenic
1137974405 16:53019045-53019067 CATGTGTGTGGTGCAGTGGCAGG - Intergenic
1138020340 16:53474133-53474155 CAGGTACATGCTGCCATGCCTGG + Intronic
1139044983 16:63047047-63047069 CAGGTGCATGCTGCAATGCCTGG + Intergenic
1139428212 16:66896096-66896118 GAGGTGGATGGTGCAGTGGTAGG - Intergenic
1141096298 16:81165472-81165494 CAGGCCCAAGGAGCAGTGGCTGG + Intergenic
1141187592 16:81798917-81798939 CAGGGACATCCTGGAGTGGCTGG - Intronic
1141858965 16:86703794-86703816 CAGGTAGATGGGGCAGGTGCTGG + Intergenic
1142218095 16:88839685-88839707 CCCGCACATGGTGCAGTGGCTGG - Intronic
1142717198 17:1753762-1753784 CCGGTACCTGGTACAGTGCCTGG - Intronic
1142908219 17:3063046-3063068 CATGTACATCCTGCTGTGGCTGG - Exonic
1142926346 17:3241215-3241237 CATGTACATCCTGCTGTGGCTGG + Intergenic
1143003509 17:3811216-3811238 CAGGTCCATGGAGCAGAGCCAGG + Intergenic
1143574839 17:7786221-7786243 CACGATCATGGTGGAGTGGCGGG - Exonic
1144017709 17:11212197-11212219 CAGGTACATGGGGCTGGGGCTGG - Intergenic
1146185152 17:30719849-30719871 CAGGTACATGGTCCTTGGGCAGG - Intergenic
1147046437 17:37755587-37755609 CAGATGCATGGCCCAGTGGCTGG + Intergenic
1148352523 17:46951036-46951058 CATGAACATGGTACAGTGACAGG - Intronic
1149575459 17:57708510-57708532 CAAATACATCGTGCAGTGCCTGG + Intergenic
1150601066 17:66651512-66651534 CAGGTACCTTTTGCAGTGACAGG + Intronic
1151167459 17:72217749-72217771 CAGGTACATGGTTGAGGGCCTGG - Intergenic
1151756951 17:76080489-76080511 CAGGTCTGTGGTGCAGGGGCAGG + Intronic
1152233084 17:79124744-79124766 CAGGTTCATGGAGCAGAGGCGGG - Intronic
1152470416 17:80487945-80487967 GAGGTACATGGTGGAGAGGATGG + Intergenic
1152470520 17:80488342-80488364 GAGGTACATGGTGGAGAGGATGG + Intergenic
1152470538 17:80488414-80488436 GAGGTACATGGTGGAGAGGATGG + Intergenic
1156071477 18:33216273-33216295 CATGTACAAAGTGCATTGGCAGG + Intronic
1157298166 18:46460925-46460947 CAGGTTCATGATGGAGAGGCAGG - Exonic
1157519880 18:48338173-48338195 CATGTACATGGTGTAATGACAGG - Intronic
1158706907 18:59800886-59800908 CAGGTGCATGGTACTGTGACAGG - Intergenic
1160020931 18:75180705-75180727 CAGGCTCAGGGTGCAGTGGAGGG - Intergenic
1160332442 18:78006908-78006930 GAGGTGCACGGTGCTGTGGCAGG + Intergenic
1161171523 19:2814605-2814627 CAGGTGCATGGAGCAGAGCCAGG - Exonic
1161879443 19:6937493-6937515 CAGGGAAATGGTCCAGTGACAGG - Intronic
1162179853 19:8860980-8861002 CAGGTACAAGGTGGGGTGGCTGG - Exonic
1163266851 19:16227034-16227056 CTGGAAGAGGGTGCAGTGGCTGG + Intronic
1164536182 19:29087933-29087955 CAGCTAGAGGGTGCAGTGGGGGG + Intergenic
1165328574 19:35128129-35128151 CAGGTACGTGGGGCAGTCCCTGG - Intronic
1166374246 19:42318223-42318245 CAGGTGCATGCTGCCATGGCTGG - Intronic
1167446804 19:49542743-49542765 CACGGACAAGGTGCAGTGACGGG + Exonic
925411847 2:3644066-3644088 GAAGTACATGGTGGTGTGGCAGG - Exonic
926060743 2:9803169-9803191 CAGGTTCAAGGTGCACTGTCAGG + Intergenic
926136274 2:10338831-10338853 CAGAAGCATGGTGCAGTGGTGGG + Intronic
932237465 2:70132255-70132277 AAGGCACATGGTACAGTGGAAGG - Intergenic
936412255 2:112271081-112271103 CAGCTACTTGGGGCAGTGGGGGG + Intergenic
936799114 2:116244741-116244763 CAGATACATGGTGGAGATGCTGG + Intergenic
937260784 2:120585841-120585863 CAGGTAATGGGAGCAGTGGCTGG + Intergenic
938015065 2:127859990-127860012 CCAGCACATGGTGCAGTGGCTGG - Intergenic
938314989 2:130319057-130319079 CAGGTACATCCAGCAGTGGGAGG - Intergenic
939044370 2:137232617-137232639 GAGATACATGCTGCAGTGGTGGG + Intronic
940044354 2:149393057-149393079 CAGGTGCATGGTGAAGTGTATGG + Intronic
942336295 2:174890410-174890432 CAGGTACATGCTACTGTAGCTGG - Intronic
944014012 2:195010416-195010438 CAGGTACCTGGAACAGTGTCTGG - Intergenic
944417388 2:199492493-199492515 CAGGGCCATGTTGCACTGGCTGG - Intergenic
948060347 2:235038876-235038898 CAGGTACATGATGTAGTGGTTGG + Intronic
1169468395 20:5861766-5861788 AAGGTGCATGGTACAGTGGGTGG - Intronic
1169657188 20:7938234-7938256 CAGCTACATGATGCAGTGTGAGG + Intronic
1170460286 20:16571425-16571447 CAGGTACATGGAGGGATGGCAGG - Intronic
1172758323 20:37303661-37303683 AAGGTACATGGGGCAGAGACTGG + Intronic
1172982374 20:38953591-38953613 CAGTTTCCTGGTCCAGTGGCAGG + Intergenic
1173895513 20:46547778-46547800 CAGGGAGATGAAGCAGTGGCTGG + Intronic
1173965564 20:47109906-47109928 CGGGTCCATAGTGCTGTGGCTGG + Intronic
1174025109 20:47567710-47567732 CAGGTACATGCTACCGTGCCCGG + Intronic
1174145793 20:48451654-48451676 CAGGTCCATGGGGCAGGGACTGG - Intergenic
1174275681 20:49402250-49402272 GAGGTACAAGCTGGAGTGGCAGG - Intronic
1174376120 20:50127914-50127936 CTCGAAGATGGTGCAGTGGCTGG + Intronic
1174591425 20:51648278-51648300 CAAGTACATGGTGCCGGGGAGGG - Intronic
1178487415 21:33027737-33027759 CTGGCACATGCTGCAGGGGCAGG - Exonic
1178820160 21:35967530-35967552 CAGGCGCAAGGTGCAGTGACTGG + Intronic
1179199753 21:39205627-39205649 CAGGTACATGCTGCCATGCCTGG - Intronic
1179727085 21:43346718-43346740 CTGGGAGATGGTGCAGTGGGAGG + Intergenic
1180581603 22:16844408-16844430 CTGGTACATGGGGTTGTGGCTGG - Intergenic
1180834134 22:18921411-18921433 CAGGTCCATGGTGCTGAGGGAGG + Exonic
1181550712 22:23637663-23637685 CAGGTAGATGCTGCAATGTCCGG - Intergenic
1181743911 22:24942614-24942636 CAGGGATATGGTGGAGTGGTTGG - Intronic
1183413839 22:37671563-37671585 CAGGGACAGGGGGCAGAGGCGGG - Intergenic
1184318589 22:43720367-43720389 CAGGTACATGCTACTGTGCCCGG - Intronic
1185214975 22:49593606-49593628 CAGGTGAAGGGTGCAGTGGCTGG - Intronic
1185370020 22:50456654-50456676 CAGGTAAGTGGGGCAGTGTCCGG - Exonic
1203284222 22_KI270734v1_random:146709-146731 CAGGTCCATGGTGCTGAGGGAGG + Intergenic
949184380 3:1172407-1172429 TAGGTACTTAGTGCAGAGGCTGG - Intronic
949233908 3:1785493-1785515 CTGGTACCTGGTGGATTGGCTGG - Intergenic
950224324 3:11221410-11221432 CAGGTGCATGCTGCCATGGCCGG - Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950902218 3:16508218-16508240 CAGTTACATGGGACAGTGGAGGG - Intronic
951733453 3:25836588-25836610 CAGGTACATGCCCCAGTGGCAGG + Intergenic
953814982 3:46147751-46147773 CTGGTCCATGGTCCAGGGGCTGG + Intergenic
954213401 3:49111000-49111022 CTGGTCCAGGGTGAAGTGGCCGG + Exonic
956106355 3:65822713-65822735 CAGGTACATCTTACAATGGCAGG + Intronic
958872076 3:99571583-99571605 CAGGTGCATGCTGCTGTGTCTGG - Intergenic
961721701 3:128901358-128901380 CTGGTACAAGGGGCTGTGGCTGG - Intronic
962156827 3:132956830-132956852 CAGGCACACGGGGCAGGGGCGGG - Intergenic
962447639 3:135481750-135481772 CAGGCACATGCTGCCGTGCCTGG - Intergenic
964308616 3:155368336-155368358 CAGGCACATGCTGCAATGCCTGG + Intergenic
967390549 3:188950021-188950043 CAAGTACATGGTACATTAGCAGG + Intronic
969111604 4:4847820-4847842 GAAGTGCATGGTGCAGTGCCTGG - Intergenic
970410832 4:15806517-15806539 CAGGTACTTGGCACAGTGGCAGG + Intronic
971473014 4:27047435-27047457 CAGATAGATGGTGCACAGGCCGG + Intergenic
971859972 4:32089905-32089927 CAGGTATCTGTTGCAGGGGCAGG + Intergenic
976156244 4:82147797-82147819 CATGTAAATGGGGCTGTGGCGGG + Intergenic
976832082 4:89327015-89327037 CAGGTAAATGGAGAAGTGGAAGG + Intergenic
977265634 4:94850059-94850081 CATGTCCATGGTGCTGTGGGAGG - Intronic
977579104 4:98705080-98705102 CAGGGACATGGTGCAGCTGTAGG - Intergenic
980376572 4:131957329-131957351 CAGGCACATGGTGCTGTTGGTGG + Intergenic
986770993 5:10973564-10973586 CAGGTGCATGGTGTACTCGCTGG + Exonic
986792934 5:11181115-11181137 CAGGAGCAGGGTGCAGTGGCGGG + Intronic
989617948 5:43356308-43356330 CAGCTACATGGGGTAGGGGCAGG - Intergenic
989727704 5:44606257-44606279 CAGGCCCAGGGTGCAGTGCCAGG + Intergenic
990438617 5:55821453-55821475 CAGGTACATGCCACAGTGCCTGG + Intergenic
991626736 5:68610743-68610765 TAGGTACAGGCTGCAGTGGGTGG - Intergenic
992811235 5:80390595-80390617 CAAGGACATGGAGCAGGGGCAGG + Intergenic
993991919 5:94668182-94668204 CAAGGACAGTGTGCAGTGGCGGG + Intronic
994994630 5:107044379-107044401 CATGGACATGGTGCAGGGGAGGG - Intergenic
998152515 5:139765367-139765389 CAGGTACTGGGGGCAGTGGGTGG - Intergenic
999633861 5:153599918-153599940 GAGGTACATGGTGGAGTCACAGG + Intronic
1001402807 5:171456021-171456043 CAGGTACAAGGGGCATGGGCAGG - Intronic
1003038441 6:2665287-2665309 CAAGGACATGGAGCAGGGGCGGG + Exonic
1004713110 6:18191314-18191336 CAGGTACATGGTGGGGTCTCGGG - Intronic
1004898710 6:20173878-20173900 GAGGTAGAAGTTGCAGTGGCCGG + Intronic
1008717527 6:54307143-54307165 CAGATCCATGGGGGAGTGGCTGG + Intergenic
1008887452 6:56446546-56446568 TAGGTACATGGGACAGTGGAGGG - Intergenic
1009585625 6:65598054-65598076 CAGGTTTAGAGTGCAGTGGCCGG - Intronic
1012652714 6:101777011-101777033 CTGGCACATGGTGCATAGGCAGG - Intronic
1014546378 6:122741407-122741429 CAGCTAGATGTTTCAGTGGCAGG - Intergenic
1014839563 6:126202141-126202163 CTGGTACATAATGCAGTGTCTGG + Intergenic
1015843036 6:137493436-137493458 CTGGCAGATGGTGCAGGGGCAGG + Exonic
1015932289 6:138373949-138373971 CAGAGAAATGGTGCAGTAGCTGG - Intergenic
1018022261 6:159772640-159772662 CTTTTACAGGGTGCAGTGGCAGG + Intronic
1019276821 7:180148-180170 CAGGTCCCTGGTGCAGGGGGTGG + Intergenic
1020231435 7:6322081-6322103 CAGGTGGATGGGGCAGGGGCAGG - Intergenic
1023500898 7:40848298-40848320 CAGGTACAAGGTAGAGTGGATGG - Intronic
1024541684 7:50479997-50480019 CAGGTACTTGGAGCAGAGACAGG - Intronic
1024687481 7:51762408-51762430 CATGTACATTGCACAGTGGCTGG - Intergenic
1026405339 7:70059650-70059672 GAGGTACATCGTACTGTGGCTGG + Intronic
1026956656 7:74380656-74380678 CAGGGACTTGCTGCGGTGGCAGG - Intronic
1028727214 7:94101168-94101190 CAGGTGCATGGAGCAGGGGGCGG - Intergenic
1030270201 7:107661695-107661717 CAGCTACATGGTGTCGCGGCCGG + Exonic
1031657404 7:124374786-124374808 CAGAAAAATGGTGCTGTGGCAGG + Intergenic
1032456299 7:132075740-132075762 CAGGGAGGTGGGGCAGTGGCGGG + Intergenic
1035238910 7:157517488-157517510 CAGGCAGGTGGTGCAGAGGCAGG + Intergenic
1036688354 8:10926227-10926249 CAGGCAAAAGGGGCAGTGGCTGG - Intronic
1037978064 8:23227543-23227565 CAGGCACATGCTGCCGTGCCTGG + Intergenic
1043636033 8:82383205-82383227 CAGGTGCATGCTGCTGTGCCTGG + Intergenic
1043878812 8:85517799-85517821 GAAGAACTTGGTGCAGTGGCTGG + Intergenic
1044846176 8:96384222-96384244 CTGGTACATGGCATAGTGGCTGG + Intergenic
1045540154 8:103076384-103076406 ATGGTACATGGTGCAGAGGAGGG + Intergenic
1045654563 8:104373635-104373657 CAGGCAAATGGTGCAGAGCCGGG + Intronic
1046409248 8:113817719-113817741 CAGCTAGATGGTGGAGTGCCTGG + Intergenic
1046645046 8:116776796-116776818 CAGGTGCATGCTACAGTGCCTGG - Intronic
1048662677 8:136623316-136623338 CAGGAAAATGTAGCAGTGGCTGG - Intergenic
1049325001 8:142017157-142017179 CAGGCACATGGGCCAGGGGCAGG + Intergenic
1049354712 8:142182019-142182041 CAGGTCCCTGGGGCAGTGGCAGG - Intergenic
1053299790 9:36940825-36940847 CAGGTACCTAGAGCAGTGCCAGG + Intronic
1055284720 9:74716271-74716293 AAGGTACTTGGTACAGTGTCTGG - Intergenic
1056663191 9:88559599-88559621 CAGGGACCTGCTGCAGTAGCTGG - Intronic
1057256317 9:93550574-93550596 CAGGTACATGGTGCAGTGGCCGG + Exonic
1057903612 9:98967698-98967720 CAGGCACAGGGTGCAGGGGCAGG - Intronic
1061169830 9:128946217-128946239 CGGCTACATAGAGCAGTGGCCGG + Exonic
1062071230 9:134555977-134555999 CAGGTACCTGGTACAGGGCCTGG + Intergenic
1062484909 9:136769910-136769932 TAGGGGCAGGGTGCAGTGGCGGG - Intergenic
1062494359 9:136824858-136824880 CAGGAAGAGGGTGCGGTGGCAGG - Intronic
1187330487 X:18334832-18334854 CAGGCACATGGAGTAATGGCGGG - Intronic
1190734132 X:53244074-53244096 CAGGCACATGGTGCCATGCCTGG - Intronic
1191084189 X:56546852-56546874 CAGGGGCATGATGCAGTGGGAGG - Intergenic
1192185250 X:68942301-68942323 CAGGTACTTGGCACAGTGCCTGG - Intergenic
1192194485 X:69019170-69019192 TAGGTAGATGGGGCAGAGGCTGG + Intergenic
1196928281 X:120655628-120655650 CAGGTACTTGGTGCCCTGGAAGG - Intergenic
1200734503 Y:6779849-6779871 CAGGCCCAGGGTGCAGTGCCAGG - Intergenic