ID: 1057258931

View in Genome Browser
Species Human (GRCh38)
Location 9:93573435-93573457
Sequence AGGACTGCTCACAGAGGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057258931_1057258939 12 Left 1057258931 9:93573435-93573457 CCTTACCCTCTGTGAGCAGTCCT No data
Right 1057258939 9:93573470-93573492 GCCCCCAGCTCACCTTCTCAGGG No data
1057258931_1057258941 13 Left 1057258931 9:93573435-93573457 CCTTACCCTCTGTGAGCAGTCCT No data
Right 1057258941 9:93573471-93573493 CCCCCAGCTCACCTTCTCAGGGG No data
1057258931_1057258938 11 Left 1057258931 9:93573435-93573457 CCTTACCCTCTGTGAGCAGTCCT No data
Right 1057258938 9:93573469-93573491 TGCCCCCAGCTCACCTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057258931 Original CRISPR AGGACTGCTCACAGAGGGTA AGG (reversed) Intergenic
No off target data available for this crispr