ID: 1057261874

View in Genome Browser
Species Human (GRCh38)
Location 9:93589078-93589100
Sequence CCCTGGACCTTGAGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057261874_1057261881 2 Left 1057261874 9:93589078-93589100 CCCAGGACCCTCAAGGTCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 258
Right 1057261881 9:93589103-93589125 TCTGAGGCTTAGTCATGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057261874 Original CRISPR CCCTGGACCTTGAGGGTCCT GGG (reversed) Intronic
901201029 1:7467544-7467566 CCCTGGTCCTTGGCTGTCCTGGG + Intronic
901201274 1:7468787-7468809 CCCTGGACCTTGATGGTTTAGGG + Intronic
901404393 1:9036588-9036610 CCCAGCACTTTGAGGGGCCTAGG + Exonic
902818622 1:18930046-18930068 CTCTGGAGCCAGAGGGTCCTGGG + Intronic
903061841 1:20674177-20674199 CCCAGGACTTTGAGGGGCCGAGG - Intronic
903261823 1:22135767-22135789 GCCTGGGCCTTGAGAGACCTAGG - Intronic
903390973 1:22963362-22963384 CCCTAGCCCCTGAGGGGCCTAGG + Intronic
903536787 1:24072132-24072154 CCCCCGACCTTGGGGTTCCTTGG + Intronic
904494436 1:30878684-30878706 CCGTGGACCTGGAGGGCTCTGGG - Exonic
904713733 1:32450971-32450993 CCCAGGACTTTGGGGGGCCTAGG - Intergenic
905405105 1:37727193-37727215 CCCTGGACCCTGAGGCAGCTGGG + Exonic
905805673 1:40875441-40875463 CCCTAGTCCTTGACAGTCCTGGG + Intergenic
907485959 1:54778292-54778314 CTCTAGACCTCAAGGGTCCTTGG + Intergenic
907689262 1:56645661-56645683 CCCTGGACCCTGTGGGGCCCGGG - Intronic
908570616 1:65406299-65406321 CGCTGTACCTGGAGGCTCCTAGG + Intronic
911398233 1:97338654-97338676 CCTTGGACCTAGAGAGTCTTAGG + Intronic
912574061 1:110648507-110648529 AGCTGGACCGTGAAGGTCCTTGG + Intergenic
912688409 1:111785252-111785274 CCCTGGCCCTTCAGGGTCTCTGG + Intronic
914430743 1:147618973-147618995 CCCTGGACCGGGAGAGTCCTGGG + Exonic
915061402 1:153188786-153188808 GCCTACACCATGAGGGTCCTGGG - Intergenic
915960762 1:160264587-160264609 CCCTGCAGCTTGAGTGTGCTTGG + Intergenic
917648214 1:177049207-177049229 TCCTGTGCCTTGGGGGTCCTGGG - Intronic
919687401 1:200497002-200497024 CCCAGGACCTTGAGAGGCCAAGG - Intergenic
922290273 1:224203840-224203862 CCCGGGACCTTGAGATGCCTTGG + Intergenic
923104284 1:230842781-230842803 CTCTGGCCCTTGAGACTCCTTGG - Intronic
924710719 1:246528038-246528060 CCCCTGACCTTGAGGGCGCTGGG + Intergenic
1064239812 10:13616191-13616213 CCATGGACATTGGTGGTCCTGGG + Intronic
1065993719 10:31036785-31036807 CCCAGCACTTTGAGAGTCCTAGG + Intergenic
1067699558 10:48559072-48559094 CCCTCAACTATGAGGGTCCTGGG + Intronic
1067925865 10:50507396-50507418 CCCAGGACCTTGGTGTTCCTGGG - Intronic
1068085480 10:52368516-52368538 CCCAGGAACTTGAGGCTGCTGGG - Intergenic
1068279982 10:54855204-54855226 CCCTGCACCTTTAGAGGCCTGGG - Intronic
1072798011 10:98371599-98371621 CCCTTGTCCCTGAGGGTGCTGGG - Intergenic
1075894555 10:125983749-125983771 GCCTGGGCCTTGAGGGTTATTGG + Intronic
1076153135 10:128179899-128179921 CCCAGCACCTTGAGGGGCCGAGG - Intergenic
1077178902 11:1203577-1203599 AACTGGACCTGGGGGGTCCTGGG - Intergenic
1077243217 11:1522443-1522465 CCCTGCACTTTGAGGGGCCGAGG - Intergenic
1077921431 11:6644807-6644829 CCCAGGACCCTGAGGCCCCTCGG + Intronic
1078741095 11:14066923-14066945 CCCAGCACTTTGAGGGGCCTAGG + Intronic
1081401889 11:42653288-42653310 CCCAGCACTTTGGGGGTCCTAGG - Intergenic
1081723379 11:45306442-45306464 CCCAGGATCCTGGGGGTCCTGGG - Intergenic
1082555598 11:54559581-54559603 CCCAGGAACCTGAGGGTACTGGG + Intergenic
1083363969 11:62130246-62130268 CCCTTGACCCTTGGGGTCCTGGG - Exonic
1083964778 11:66036664-66036686 CCCAGCACTTTGAGGGTCCAAGG + Intergenic
1085506977 11:77066511-77066533 CCCTGGCCCTTGCGGGTCCTCGG + Intergenic
1087570815 11:99925574-99925596 CCCTTGGCCTTGAGACTCCTTGG + Intronic
1092915611 12:13186493-13186515 CCCTGCACCTTGAGTGAGCTAGG - Intergenic
1094870266 12:34595744-34595766 CCCTGGGCCTTGGGGATCCTGGG + Intergenic
1099438027 12:82666760-82666782 CCCTGGAACCTGAAGGTGCTTGG - Intergenic
1101782595 12:107849050-107849072 TCCTGGATCCTGAGGGTCTTTGG + Intergenic
1102066732 12:109982894-109982916 CCCAGCACTTTGAGGGTCCAAGG - Intronic
1102112240 12:110373256-110373278 CCCTGGAGCCTGAGAGTCTTTGG - Exonic
1103516316 12:121510540-121510562 CCCTACACTTTGAGGGGCCTAGG + Intronic
1103581524 12:121918795-121918817 ACCTGGCCCTTGTGGGGCCTGGG + Intronic
1104584457 12:130036902-130036924 CACTGGACCTTGAGGCCCCATGG - Intergenic
1105506818 13:21017423-21017445 CCCTGTACCTTGAGAGGCCGAGG - Intronic
1106369064 13:29113778-29113800 GACTGGAACTTTAGGGTCCTGGG + Intronic
1107986766 13:45782843-45782865 GCTTTGACCTTGAGGTTCCTGGG + Exonic
1108559516 13:51628447-51628469 CCCTGGACTCTCAGGGGCCTGGG - Intronic
1108736727 13:53291813-53291835 CCCTGCACTGGGAGGGTCCTTGG + Intergenic
1109242204 13:59902965-59902987 CCATAGAACTTGAGGGACCTTGG + Intronic
1109964678 13:69676530-69676552 CCCTGGACATTGAGGGTGATAGG - Intergenic
1114632265 14:24166710-24166732 GCCTGGGCCCTGTGGGTCCTGGG + Exonic
1115755072 14:36521061-36521083 CCCCGCGCCTTGAGGGTCCTTGG + Intronic
1119662700 14:76462995-76463017 CCCAAGCCCTTGAGGGTGCTAGG - Intronic
1119781107 14:77277412-77277434 CATTGGACTTTGGGGGTCCTGGG + Exonic
1121908003 14:97765053-97765075 CACTGGACCCTGAGGGCCCCTGG - Intergenic
1123099448 14:105786564-105786586 CCCTGTACCCTGAGGGTGCTTGG + Intergenic
1124721874 15:32117569-32117591 TCCTAGGACTTGAGGGTCCTAGG + Intronic
1125403351 15:39327777-39327799 CCCTGGACCCTGAGAGTCTGAGG - Intergenic
1127799105 15:62462517-62462539 ATCTGGACCCTGAGGGTCCAGGG - Intronic
1128523044 15:68388023-68388045 CCCTGCACCTGGATGGCCCTTGG + Intronic
1129206952 15:74043046-74043068 TCCAGGACCCTGAGGGTGCTGGG - Exonic
1132265436 15:100466364-100466386 CCCTGGACCTAGAGCTTCCATGG + Intronic
1132997150 16:2829356-2829378 CCTGGGTCCTTCAGGGTCCTTGG + Intergenic
1133613509 16:7454799-7454821 CTCTTGACCTTCTGGGTCCTGGG + Intronic
1133902112 16:9986512-9986534 CCCAGCACCTTGAGGGGCCAAGG + Intronic
1134298622 16:12969491-12969513 CCCAGGACTTTGAGAGGCCTAGG + Intronic
1134467381 16:14491511-14491533 CCCTGCACCTTGAGAGGCCCAGG + Intronic
1134805069 16:17117582-17117604 CTGGGGACCTTGAGGGTCTTTGG - Intronic
1135774267 16:25242609-25242631 CCCTCCACCTTGAATGTCCTTGG - Intronic
1137305954 16:47200093-47200115 CCCTGGACCGTATGGGTCCCTGG - Intronic
1138121058 16:54401458-54401480 CCCTGAACCTTGATGCTCCTAGG + Intergenic
1138152301 16:54669989-54670011 CACTGGGACTTCAGGGTCCTGGG - Intergenic
1139410043 16:66751634-66751656 CCCGGGTCCTCGCGGGTCCTCGG - Exonic
1139646529 16:68335257-68335279 CACTAGACCTTGTGGGTGCTGGG + Intronic
1143627480 17:8118798-8118820 CCCTGGGCCTGCAGGATCCTGGG + Exonic
1144004917 17:11091091-11091113 CCCTGGATCCTGAAGTTCCTGGG + Intergenic
1144999015 17:19290479-19290501 CCCTGGCCTTAGAGTGTCCTTGG - Intronic
1145237676 17:21220568-21220590 CCCAGCACCTTGAGGGGCCAAGG - Intergenic
1145971349 17:28958235-28958257 TCCTGGACCTAGACTGTCCTGGG + Intronic
1146210628 17:30939901-30939923 CCCTAGCAATTGAGGGTCCTGGG + Intronic
1146842591 17:36166241-36166263 ACCTGGACGTAGAGGGGCCTTGG - Exonic
1146854904 17:36254200-36254222 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146865716 17:36334176-36334198 ACCTGGACGTAGAGGGCCCTTGG + Exonic
1146870804 17:36378092-36378114 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146878163 17:36429174-36429196 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146882112 17:36450320-36450342 ACCTGGACGTAGAGGGCCCTTGG - Intergenic
1147068585 17:37934788-37934810 ACCTGGACGTAGAGGGCCCTTGG + Exonic
1147073688 17:37978716-37978738 ACCTGGACGTAGAGGGCCCTTGG - Intronic
1147080108 17:38014325-38014347 ACCTGGACGTAGAGGGCCCTTGG + Intronic
1147085209 17:38058254-38058276 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1147096057 17:38138285-38138307 ACCTGGACGTAGAGGGCCCTTGG + Intergenic
1147101156 17:38182220-38182242 ACCTGGACGTAGAGGGCCCTTGG - Intergenic
1147538427 17:41335607-41335629 CCCCTGACCTTGAGGGCACTGGG + Intergenic
1148165492 17:45481616-45481638 CCCTAGCTCTGGAGGGTCCTGGG + Intronic
1150227504 17:63531879-63531901 CCCTGCTCCATGTGGGTCCTAGG + Intronic
1150396719 17:64828332-64828354 CCCTAGCTCTGGAGGGTCCTGGG + Intergenic
1151257158 17:72886784-72886806 CCCTGGAGCTTGTAGGTGCTTGG - Intronic
1151930898 17:77230664-77230686 CGACGGTCCTTGAGGGTCCTTGG + Intergenic
1153885690 18:9463591-9463613 CCCAGCACTTTGAGAGTCCTAGG + Intergenic
1156290963 18:35748269-35748291 CCCTGCACCTGGAGTCTCCTCGG - Intergenic
1157132879 18:45023968-45023990 CCCTGGAGCCAGACGGTCCTTGG - Intronic
1157883641 18:51345514-51345536 AGCTGGACCTTGCGGCTCCTTGG + Intergenic
1158106280 18:53888438-53888460 ACCTGGACCTGCATGGTCCTTGG - Intergenic
1158267683 18:55678092-55678114 CCCTGGATGTAGAGGGTGCTGGG + Intergenic
1160036024 18:75302519-75302541 CCCTGGACAGTGGGGGCCCTTGG + Intergenic
1160583663 18:79901266-79901288 CCCTGGTCCTGGAGGGCTCTGGG - Intergenic
1160836609 19:1127526-1127548 CACTGGACCGTGTGGGTCCCGGG + Intronic
1161723641 19:5916634-5916656 CCCTGGCCCTGGACTGTCCTGGG + Exonic
1161825234 19:6559146-6559168 CCCTGCACTTTGAGGGGCCGAGG - Intergenic
1161942699 19:7415549-7415571 CCATGGGCCTTGGGGGCCCTTGG - Intronic
1162094442 19:8302287-8302309 CCCTGGAGATTGAGGGTCCCTGG - Exonic
1162503365 19:11067354-11067376 CCCTGGAGTTTGAGTGTACTTGG + Intergenic
1163509543 19:17726766-17726788 CCCAGGACCTGGAGGGGCCGGGG + Exonic
1163628336 19:18403646-18403668 TCCTGGGGCCTGAGGGTCCTGGG + Intergenic
1163664196 19:18595343-18595365 CCCTGAACCTGGAGGGGCCCAGG + Intronic
1164174664 19:22760492-22760514 CCCAGCACCTTGAGAGGCCTAGG + Intronic
1164628594 19:29746124-29746146 CCCAGGACCTTGGGGGGCCGAGG - Intergenic
1165071708 19:33259578-33259600 CCCTGGGCCTTGTGGCTCCAAGG + Intergenic
1165090966 19:33388273-33388295 CCCTGGATCTTGAGTGTCCCTGG + Intronic
1165579615 19:36850799-36850821 CCCTGGGCCTAGAGGCTTCTGGG - Intronic
1166083824 19:40461968-40461990 CCCTGGACCCACAGGGTGCTTGG - Intronic
1166284110 19:41813127-41813149 CTCAGGACCTGGAGGGTGCTGGG - Intergenic
1166409790 19:42548849-42548871 CTCAGGACCTGGAGGGTGCTGGG + Intronic
1167463073 19:49636452-49636474 AACTGGACCTTCAGGGTCCCCGG - Intronic
1167763304 19:51462633-51462655 CTCTGGAGTGTGAGGGTCCTGGG + Intergenic
1168635065 19:57989800-57989822 CCCAGCACTTTGAGAGTCCTAGG + Intronic
926087313 2:10028578-10028600 GCCTGGAGCATGAGGGGCCTGGG - Intergenic
926095038 2:10075821-10075843 CCCTTGACCTTGAGTGACCCAGG + Intronic
926859423 2:17292406-17292428 CCATGGAGCTGGAGGGACCTGGG - Intergenic
927948073 2:27149310-27149332 CCCTGGCCCTCGAGGGACCAGGG + Exonic
928029723 2:27768101-27768123 ACCTGGTCCTTGAGGGACTTAGG + Intergenic
928180628 2:29065894-29065916 CCCAGCACTTTGAGAGTCCTAGG + Intronic
928215269 2:29356070-29356092 CCTTGGACCTCGAGGGGCCTTGG - Intronic
930053335 2:47233983-47234005 CCCTGCTCCTTCAGGGTCTTTGG + Intergenic
932277528 2:70462753-70462775 CCCTGGATCTTGATGGCCCAGGG - Intronic
932337698 2:70940300-70940322 CCCTGGACTTTTCTGGTCCTTGG + Exonic
933721217 2:85398775-85398797 CCCTGGCCCCTGCAGGTCCTGGG - Exonic
933832177 2:86219896-86219918 CCCTGGAGATTGGGGGTCCTGGG - Intronic
933857262 2:86427995-86428017 CCCAGCACTTTGAGGGTCCAAGG + Intergenic
935249901 2:101252399-101252421 CCCAGCACTTTGAGAGTCCTAGG - Intronic
935737824 2:106120363-106120385 CCCTTGACCCTAGGGGTCCTGGG - Intronic
937099493 2:119257800-119257822 CCATGGTTCTTGAGGGGCCTTGG + Intronic
937123083 2:119454192-119454214 CCCTGGCCCTAGAGCATCCTTGG - Intronic
939748624 2:146011377-146011399 CCCAGCACTTTGAGGGTCCAAGG + Intergenic
940366366 2:152852641-152852663 TCCTGGACTTTCAGGGTCCCTGG + Intergenic
941767908 2:169318197-169318219 CCCTGGACATTGAGGGGGTTTGG - Intronic
943261716 2:185673117-185673139 CCCTGGACAGTGAGTTTCCTTGG - Intergenic
943423537 2:187699314-187699336 CCCTGTACTTTGAGAGGCCTAGG - Intergenic
946431223 2:219628129-219628151 CCCTGGATCTGGGGGGTCCCGGG - Intronic
949022938 2:241751768-241751790 GCCTGGACCTCGGGAGTCCTAGG + Intronic
949034915 2:241811897-241811919 GCCTGCACCGTGAGCGTCCTGGG - Intronic
1168940999 20:1711532-1711554 GCCTGGACTTTCAGGGTCCCTGG - Intergenic
1169522388 20:6387558-6387580 CCCTGGAGTTTGAGGTTTCTGGG + Intergenic
1170780806 20:19423743-19423765 CTCTGGACATTGAGGGTGCCAGG + Intronic
1172612560 20:36262662-36262684 CCCTTCACCTTGCGGGGCCTTGG - Intronic
1173686718 20:44929020-44929042 CCCTGCACCTTGGGAGACCTAGG + Intronic
1174554928 20:51387429-51387451 CCCTGAGCCATCAGGGTCCTGGG - Exonic
1176326098 21:5502460-5502482 TCCTGCACCTTGAGAGCCCTGGG - Intergenic
1176401659 21:6318491-6318513 TCCTGCACCTTGAGAGCCCTGGG + Intergenic
1176413259 21:6460116-6460138 CCGTGGGCCTGGGGGGTCCTGGG - Intergenic
1176435498 21:6670613-6670635 TCCTGCACCTTGAGAGCCCTGGG - Intergenic
1176459760 21:6997683-6997705 TCCTGCACCTTGAGAGCCCTGGG - Intergenic
1176483321 21:7379461-7379483 TCCTGCACCTTGAGAGCCCTGGG - Intergenic
1179389003 21:40970317-40970339 CCATGGACCTTGAAAGCCCTAGG + Intergenic
1179688756 21:43068438-43068460 CCGTGGGCCTGGGGGGTCCTGGG - Intronic
1179947452 21:44687738-44687760 CCCTGGGCCTTGAGGGGGCCTGG + Intronic
1180954607 22:19736095-19736117 CCCTGCAACTTCAGGGTGCTTGG + Intergenic
1181006126 22:20014570-20014592 AGCTGGGCCTTGGGGGTCCTGGG - Intronic
1181043703 22:20204778-20204800 CCGTGGACCTGGCAGGTCCTAGG - Intergenic
1184242548 22:43218822-43218844 GGCTGGACCTTGAAGGGCCTTGG - Intronic
1184641693 22:45876398-45876420 CTCTGGACATTGAGGCTCCTTGG + Intergenic
1185035508 22:48474672-48474694 TCCTGGTCCCTCAGGGTCCTAGG - Intergenic
951351427 3:21611696-21611718 CCCTTGACCATGAGGGTTCATGG - Intronic
953206844 3:40838551-40838573 TCCTGGGCCTTGAGGCTCTTTGG + Intergenic
953238921 3:41131001-41131023 TCCTGGACCCAGAGGGTTCTTGG + Intergenic
953773889 3:45799502-45799524 ACCTGGACCATGAGGCTGCTGGG + Intergenic
953907802 3:46877050-46877072 CCCTGGGCCTGGAAGGGCCTGGG + Intronic
955903542 3:63783103-63783125 CTCTGGACCTGGACAGTCCTGGG - Intergenic
956762114 3:72452742-72452764 ACCTGGAGCTGGAGGGTCTTAGG + Intergenic
958407306 3:93765053-93765075 CCCAGGACCTTGGGAGTCCAAGG + Intergenic
961743970 3:129051634-129051656 TCCTGTAACTTGAGGGTCCTAGG + Intergenic
962103193 3:132364091-132364113 CCCAGCACCTTGAGAGTCCGAGG + Intronic
965461316 3:168967819-168967841 CCCTTGACCTTGAACTTCCTAGG - Intergenic
968861954 4:3179331-3179353 TCCTGGACTTGGAGGGTCTTTGG + Intronic
969373229 4:6747223-6747245 ACCTGGACGCTGAGGGCCCTTGG - Intergenic
969929235 4:10613965-10613987 GCCTGGGCATTCAGGGTCCTTGG - Intronic
969945838 4:10782437-10782459 CTCTGGACCTTGAGGGTCACAGG - Intergenic
970913561 4:21307070-21307092 CCCAGGACTTTGGGGGTCCAAGG - Intronic
973870360 4:55159988-55160010 CTCAGGACCTAGAGGGTCCCTGG + Intergenic
976219041 4:82741325-82741347 GCCTGGGCCTTGAGAGGCCTTGG + Intronic
978232971 4:106423347-106423369 CCCTGGATAGTGAGGGCCCTGGG + Intergenic
981920793 4:150082464-150082486 CCCTTGACCTTGAGAGTCTCTGG + Intronic
982435838 4:155383117-155383139 CCCCTGACCTTGAGGGTGCTGGG - Intergenic
985182484 4:187280260-187280282 CCCAGGACTTTGAGAGGCCTAGG + Intergenic
985499421 5:232469-232491 CCCAGGACCCTGAGGGGCCGAGG - Intronic
985827695 5:2205048-2205070 CCCAAGACCTCCAGGGTCCTTGG - Intergenic
987570642 5:19653772-19653794 CACTGGAGCTTAAGGATCCTAGG - Intronic
988457601 5:31400368-31400390 CCCTGGTCCTTGAGGAGCTTGGG - Intergenic
991913980 5:71587829-71587851 CTCTGGACCTTGTGGGTCTCAGG + Intronic
994517884 5:100793872-100793894 CCCTGCACTTTTGGGGTCCTGGG + Intergenic
995214512 5:109580322-109580344 CCCTGGACCTTTGGGGGACTTGG - Intergenic
995793944 5:115922666-115922688 GCCTGGATCCTGAGGGTTCTGGG + Intergenic
996000121 5:118351052-118351074 CCTTGGACTTAGAGGGTCTTGGG + Intergenic
996517327 5:124386110-124386132 CCCAGGACCTGACGGGTCCTGGG + Intergenic
997830380 5:137144646-137144668 CCCTGAGCCTTGAGGCTGCTAGG - Intronic
998041182 5:138951867-138951889 ACCTGGACCTTGGGGTTGCTGGG + Exonic
999350203 5:150862819-150862841 CCCTAGACCAGGAGGGACCTGGG + Intronic
999527031 5:152418148-152418170 CCCAGGACCTTGGGAGGCCTAGG + Intronic
1000555295 5:162718334-162718356 TCCTGGACCCTGAGAGTCTTTGG + Intergenic
1000770432 5:165346807-165346829 CCCAGCACCTTGAGGGGCCAAGG + Intergenic
1001277350 5:170360306-170360328 CTCTGGACCCAGAGGGACCTGGG + Intronic
1002541009 5:179906938-179906960 CCCTGGAGCATGAGGGGCCCCGG + Intronic
1003940151 6:11016568-11016590 GCCTTGACCTTGAGGTTCCTGGG - Intronic
1003955851 6:11164471-11164493 CCTTTGACCCTGAGTGTCCTAGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006848812 6:37082450-37082472 CCCTGCACTTTGAGGGGCCGAGG + Intergenic
1011931340 6:92718152-92718174 CCCAGCACTTTGAGGGTCCAAGG - Intergenic
1012835165 6:104255422-104255444 GCCTGGACATTGAGAGGCCTTGG + Intergenic
1015524536 6:134163229-134163251 CCCAGGACCTTGAGAGTCCAAGG + Intergenic
1016006984 6:139099269-139099291 CTCTGGGCCTTCAGGGTCATAGG + Intergenic
1017021361 6:150142941-150142963 GGCTGGACCGAGAGGGTCCTCGG + Intergenic
1017567350 6:155701665-155701687 CCCTGGTCCCTGTGGCTCCTGGG - Intergenic
1019183739 6:170208966-170208988 CCCTGGGCCTGGTGGGTGCTGGG - Intergenic
1019613658 7:1949096-1949118 CCCTGCTCCTTGAGGCTCCAGGG + Intronic
1020446092 7:8269400-8269422 CCCAGGACCATGAGGGTCTGTGG + Intergenic
1022497774 7:30863935-30863957 CCCAGGACCCTGAGCATCCTTGG - Intronic
1022516534 7:30978269-30978291 CCATGGGCCCTGGGGGTCCTGGG + Intronic
1027237803 7:76308247-76308269 CCCAGCACCTTGGGGGGCCTAGG + Intergenic
1029101932 7:98138247-98138269 CACTGGACCTCCAGGCTCCTGGG - Intronic
1030596007 7:111539543-111539565 CCCTGGCCCTTGAGACTCCAGGG - Intronic
1035246065 7:157562582-157562604 CCCCGGACTTTGAAGGTCCCCGG - Intronic
1035999852 8:4589936-4589958 CACTGGACCTGGAAGTTCCTAGG + Intronic
1036170412 8:6479012-6479034 CCCAGCACTTTGAGGGTCCCAGG + Intronic
1041278807 8:56190805-56190827 CCCTGTGCCTTGATGGTCTTTGG - Intronic
1041378249 8:57224073-57224095 CCCAGCACTTTGAGGGCCCTGGG + Intergenic
1043760486 8:84062471-84062493 CCCAGGACCTTGAGAGTACATGG - Intergenic
1044658237 8:94570679-94570701 CCCAGCACCTTGAGGGGCCCAGG + Intergenic
1044824523 8:96183628-96183650 CCCTGTAGCTGGAGGGACCTTGG - Intergenic
1045163397 8:99574911-99574933 CCCAGCACTTTGAGAGTCCTAGG + Intronic
1045223526 8:100222027-100222049 TCCTTGACCTTGAGCTTCCTTGG + Intronic
1045823832 8:106373176-106373198 ACCTGGAACTTGAGTATCCTTGG + Intronic
1049761651 8:144334420-144334442 CCCCTGACCTTGAGGCTCCGCGG - Intronic
1050385697 9:5088219-5088241 TCCTGGGTCTTGAGAGTCCTGGG + Intronic
1051027013 9:12625002-12625024 CCCACCACCTTGAGGGTCCATGG + Intergenic
1052341175 9:27365794-27365816 CCCTGGACCTGGATGGCCTTGGG + Intronic
1056107578 9:83362531-83362553 CCCTGCCCCTTCAGGGTGCTTGG + Intronic
1056177757 9:84051989-84052011 CCCTGGACTTTGAAGGTATTAGG + Intergenic
1056476745 9:86960017-86960039 TCCAGGACCTAGAAGGTCCTAGG - Intergenic
1057048852 9:91906802-91906824 GCCTGGACCTTGGAAGTCCTTGG - Intronic
1057261874 9:93589078-93589100 CCCTGGACCTTGAGGGTCCTGGG - Intronic
1058433441 9:104939820-104939842 CCCTGCACTTTGAGAGGCCTAGG + Intergenic
1060297752 9:122354897-122354919 GCCTGGACCTTGAGGCACATGGG - Intergenic
1060303202 9:122388294-122388316 CCCAGCACCTTGAGAGGCCTAGG - Intronic
1061390995 9:130316931-130316953 CTCTGGCCTATGAGGGTCCTGGG + Intronic
1062020864 9:134318826-134318848 TCCTGGACTTTGAGGGGCCCAGG - Intronic
1062077807 9:134601377-134601399 CCTTGTACCTTGAGGGTCAGGGG - Intergenic
1062541174 9:137042186-137042208 CCCTGGACCTTGTGGGGTGTTGG - Intronic
1185906418 X:3937888-3937910 GCCTGGGCTTTGAGGTTCCTTGG - Intergenic
1192358096 X:70422338-70422360 CCATGGGCCTTGTGGATCCTGGG - Intergenic
1196678774 X:118448797-118448819 CCCTGAAGCTGGAGGGTCATGGG + Intronic
1196832131 X:119784011-119784033 CCCAGCACTTTGAGGGGCCTAGG - Intergenic
1197654497 X:129102028-129102050 CCCAGCACCTTGGGAGTCCTAGG + Intergenic
1199649352 X:149938219-149938241 CTCTGGACCCTGAGAGTCGTGGG + Exonic
1200073134 X:153538705-153538727 CCCTGGACCTGGACTGCCCTCGG + Intronic