ID: 1057263836

View in Genome Browser
Species Human (GRCh38)
Location 9:93601239-93601261
Sequence CTGTCTGCACATATACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057263832_1057263836 -8 Left 1057263832 9:93601224-93601246 CCCACCCAGGTTTGGCTGTCTGC 0: 1
1: 0
2: 3
3: 11
4: 160
Right 1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG No data
1057263822_1057263836 25 Left 1057263822 9:93601191-93601213 CCCATCTACTGAAACCGTGCAGA 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG No data
1057263831_1057263836 -2 Left 1057263831 9:93601218-93601240 CCGGGGCCCACCCAGGTTTGGCT 0: 1
1: 0
2: 4
3: 30
4: 226
Right 1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG No data
1057263833_1057263836 -9 Left 1057263833 9:93601225-93601247 CCACCCAGGTTTGGCTGTCTGCA 0: 1
1: 0
2: 2
3: 15
4: 207
Right 1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG No data
1057263823_1057263836 24 Left 1057263823 9:93601192-93601214 CCATCTACTGAAACCGTGCAGAT 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG No data
1057263828_1057263836 11 Left 1057263828 9:93601205-93601227 CCGTGCAGATTGGCCGGGGCCCA 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057263836 Original CRISPR CTGTCTGCACATATACAGCC AGG Intronic
No off target data available for this crispr