ID: 1057264005

View in Genome Browser
Species Human (GRCh38)
Location 9:93602125-93602147
Sequence CCAGTTCACGAGTTCTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057264003_1057264005 4 Left 1057264003 9:93602098-93602120 CCTGGGTTGTTTCTTCAGATCTC 0: 1
1: 0
2: 4
3: 26
4: 282
Right 1057264005 9:93602125-93602147 CCAGTTCACGAGTTCTCTGAAGG No data
1057263998_1057264005 24 Left 1057263998 9:93602078-93602100 CCTGCTTCTCTGTGTCCCAGCCT 0: 2
1: 1
2: 4
3: 73
4: 598
Right 1057264005 9:93602125-93602147 CCAGTTCACGAGTTCTCTGAAGG No data
1057264001_1057264005 9 Left 1057264001 9:93602093-93602115 CCCAGCCTGGGTTGTTTCTTCAG 0: 1
1: 0
2: 2
3: 26
4: 475
Right 1057264005 9:93602125-93602147 CCAGTTCACGAGTTCTCTGAAGG No data
1057264002_1057264005 8 Left 1057264002 9:93602094-93602116 CCAGCCTGGGTTGTTTCTTCAGA 0: 1
1: 0
2: 3
3: 24
4: 391
Right 1057264005 9:93602125-93602147 CCAGTTCACGAGTTCTCTGAAGG No data
1057263997_1057264005 30 Left 1057263997 9:93602072-93602094 CCTCTACCTGCTTCTCTGTGTCC 0: 1
1: 0
2: 14
3: 67
4: 684
Right 1057264005 9:93602125-93602147 CCAGTTCACGAGTTCTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057264005 Original CRISPR CCAGTTCACGAGTTCTCTGA AGG Intronic
No off target data available for this crispr