ID: 1057264579

View in Genome Browser
Species Human (GRCh38)
Location 9:93606089-93606111
Sequence CAGCTACTTACTTAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057264579_1057264586 28 Left 1057264579 9:93606089-93606111 CCAGCCTCCTAAGTAAGTAGCTG 0: 1
1: 1
2: 0
3: 14
4: 132
Right 1057264586 9:93606140-93606162 TTGTATTTTTTGTAGAGATGGGG 0: 4126
1: 94416
2: 185410
3: 185009
4: 121101
1057264579_1057264584 26 Left 1057264579 9:93606089-93606111 CCAGCCTCCTAAGTAAGTAGCTG 0: 1
1: 1
2: 0
3: 14
4: 132
Right 1057264584 9:93606138-93606160 TTTTGTATTTTTTGTAGAGATGG 0: 6493
1: 211270
2: 146912
3: 70533
4: 147369
1057264579_1057264585 27 Left 1057264579 9:93606089-93606111 CCAGCCTCCTAAGTAAGTAGCTG 0: 1
1: 1
2: 0
3: 14
4: 132
Right 1057264585 9:93606139-93606161 TTTGTATTTTTTGTAGAGATGGG 0: 4530
1: 102448
2: 256591
3: 163839
4: 90505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057264579 Original CRISPR CAGCTACTTACTTAGGAGGC TGG (reversed) Intronic
900436271 1:2632747-2632769 CAGCCCCTTTCTCAGGAGGCTGG - Intronic
901910531 1:12453916-12453938 CAAAAACTTACTTGGGAGGCTGG + Intronic
902170457 1:14606229-14606251 ATGCTTCTGACTTAGGAGGCAGG - Intronic
902426560 1:16328184-16328206 AAACCACTTACTCAGGAGGCTGG + Intronic
904351951 1:29914181-29914203 CACCTACCTACAGAGGAGGCTGG - Intergenic
905917411 1:41695337-41695359 CAGCCACTTCCTTATCAGGCTGG + Intronic
907884244 1:58578190-58578212 CAGCTACTTACGTGGGATACAGG - Intergenic
908425198 1:64000556-64000578 CAACTAGTTACTAAGGAGGCAGG - Intronic
909629937 1:77760403-77760425 CAGTTACATAATTAGAAGGCAGG - Intergenic
910964362 1:92793419-92793441 CAGCTACTTTCCTAAGAGGAAGG + Intergenic
920587079 1:207175763-207175785 CAGCTACTGAGTCAGGAGGATGG - Intergenic
921275220 1:213512471-213512493 CAGCTTCTTAAGTAGCAGGCTGG - Intergenic
924748666 1:246863460-246863482 CAGCTAATAACTTAGGAGATGGG + Intronic
1062993555 10:1843555-1843577 CAGCTATTTACTCAGGTGTCAGG - Intergenic
1063301494 10:4853302-4853324 CAACTACTAATTTATGAGGCTGG - Intergenic
1063641943 10:7838765-7838787 CAGATCCTTAACTAGGAGGCTGG - Intronic
1066485985 10:35845580-35845602 CTGCCAGCTACTTAGGAGGCTGG - Intergenic
1066644035 10:37586724-37586746 CAGCTAGCTACGCAGGAGGCTGG + Intergenic
1070205353 10:74253520-74253542 CCCCTACTGAGTTAGGAGGCAGG - Intronic
1070481123 10:76883790-76883812 CATCTGCTTACTTAGGAAGTAGG - Intronic
1071306176 10:84300620-84300642 CAGCTACTGAGGTAGGAGGTAGG + Intergenic
1073959625 10:108911856-108911878 CAGCTACTCCGTTAGGAGGCGGG + Intergenic
1075468276 10:122668558-122668580 CAGCTACTTACCTAGGAATGGGG + Intergenic
1079392940 11:20037937-20037959 CATCTACATATTCAGGAGGCAGG + Intronic
1085025744 11:73235560-73235582 CAGCTACTTGCATGGGAGTCAGG - Exonic
1087145948 11:94811827-94811849 CAGCTACTTACCTAGGAGTGGGG + Intronic
1087734581 11:101817417-101817439 CTGCTCCTTACTCAGGAGTCAGG - Intronic
1088065887 11:105718891-105718913 CAGCTGCTTACTTAGGAGTTTGG + Intronic
1088122939 11:106390902-106390924 CAGCTAATAACTTAGAAGGGTGG + Intergenic
1098460749 12:70730704-70730726 GTCCTATTTACTTAGGAGGCTGG + Intronic
1098992798 12:77083487-77083509 GTCCTACTTACTCAGGAGGCTGG + Intergenic
1100070236 12:90707640-90707662 CAGCTAGCTACTCAGGAGGTTGG - Intergenic
1102882536 12:116497029-116497051 CACCGGCTTACTTAGGAGACAGG - Intergenic
1104502527 12:129300174-129300196 CAGCTACTTAATTAAGATGCAGG + Intronic
1105407578 13:20144686-20144708 CTGCTGCTTTCTTAGCAGGCTGG - Intronic
1106373056 13:29155927-29155949 CAGATATTGACATAGGAGGCAGG + Intronic
1110705774 13:78601406-78601428 CTGCCACTTACTGAGGGGGCTGG - Exonic
1111831444 13:93335123-93335145 TAGCTAATTATTTAGAAGGCAGG + Intronic
1114940775 14:27607460-27607482 CAGCTACTTACCTAGGAATGGGG - Intergenic
1118904055 14:70010665-70010687 TTGCTACTTACTTTGGATGCTGG + Intronic
1119566116 14:75630776-75630798 GTGCCACTTACTGAGGAGGCAGG - Intronic
1122209854 14:100167012-100167034 CAGCTACTGAGTTAGGAGAATGG + Intergenic
1123928161 15:25139318-25139340 CAGCTACTGAGTGAGGAGCCAGG + Intergenic
1130484649 15:84391978-84392000 CAGCTCCTTCCTTAGGTGGTTGG - Intergenic
1131086621 15:89580916-89580938 CAGCTACTTACTCAGGAGGCTGG + Intronic
1131528676 15:93173526-93173548 AAGCTGAGTACTTAGGAGGCAGG + Intergenic
1132375758 15:101327213-101327235 CAGCTTCTCACTCCGGAGGCTGG + Intronic
1135379287 16:21980814-21980836 CATCTACTTAATGTGGAGGCAGG + Intronic
1135941871 16:26828800-26828822 CTCCTAGTTACTTGGGAGGCTGG + Intergenic
1138230723 16:55333976-55333998 CAGCTACTAAGTAAAGAGGCAGG + Intergenic
1139247447 16:65459842-65459864 CAGGTTCTCACTTAGGAGTCTGG + Intergenic
1139674229 16:68511844-68511866 CAGCTACTCACCTGGCAGGCAGG + Intergenic
1141417996 16:83891772-83891794 CAGCTACTTGGTTAGGCAGCAGG + Intergenic
1141627454 16:85268779-85268801 CAGGTTCTTACCCAGGAGGCTGG - Intergenic
1145212663 17:21026435-21026457 CAGCTACTCACTCAGGAGGTGGG - Intronic
1146808824 17:35887431-35887453 CAGCTACTCAGTGGGGAGGCAGG + Intergenic
1147017551 17:37504493-37504515 CTTCTACTTACTTTGGAGGAGGG - Intronic
1148820041 17:50354951-50354973 CAGGTACATCCTCAGGAGGCTGG - Exonic
1164792075 19:30995849-30995871 CATCTACTTCCTTAGCTGGCTGG - Intergenic
1165353955 19:35292313-35292335 CCGCTACTGATTTAGGATGCAGG + Intronic
1166279606 19:41782818-41782840 CAGTTACTTACTTGGGAGGTTGG + Intergenic
1168425909 19:56238516-56238538 CAGATACTCACTCAGGAGGCTGG + Intronic
926878737 2:17517248-17517270 CAGTTACGTACTTACCAGGCTGG - Exonic
929458363 2:42083015-42083037 CACCAACTTACTTTGCAGGCTGG + Intergenic
930806407 2:55494986-55495008 CAGCTACTCACTTGGGAAGCTGG + Intergenic
938578305 2:132623604-132623626 CAGCTAGTTAGTGAGGAGCCAGG - Intronic
938800141 2:134755190-134755212 CAGCTACTCAGGTAGGAGGTAGG + Intergenic
938970397 2:136425972-136425994 CAGCTGCTGACAGAGGAGGCTGG + Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
941662506 2:168209560-168209582 CAGCTACTTACTCGGTTGGCTGG + Intronic
941815872 2:169795529-169795551 CAGCTTCTTAATTATGAGGCTGG - Intronic
942342833 2:174967228-174967250 CAGCTACTGGGGTAGGAGGCAGG + Intronic
943730728 2:191300717-191300739 CACCTACCTACTCAGGAGGTAGG - Intronic
943765970 2:191663063-191663085 CATCTACTAACTTATGAGCCTGG + Intergenic
944767194 2:202876272-202876294 CAGGTACGTACTCAGGAAGCTGG + Exonic
1173442313 20:43088904-43088926 GAGCTACTTGCATAGGAGTCAGG - Intronic
1173572960 20:44089583-44089605 CAGCTACTTTCAGAGGAGGATGG - Intergenic
1173639069 20:44586558-44586580 CAGCTTCTTCCTTAAGTGGCTGG - Intronic
1175417186 20:58809508-58809530 CAGCTAGTTAGTGAGGGGGCTGG + Intergenic
1175580038 20:60091417-60091439 TAGCTGCTTACTTGGGAGGCTGG + Intergenic
1178235673 21:30838356-30838378 GAGCTACTTCCTTTGGTGGCTGG - Intergenic
1181083712 22:20429719-20429741 CATCCACTTACCTAGGTGGCAGG + Exonic
1182767006 22:32764945-32764967 CATCTCCTTATTTGGGAGGCAGG + Intronic
1183355838 22:37358946-37358968 CTGCCACTTACATAGGAAGCAGG + Intergenic
1183774636 22:39955899-39955921 CAGATACTTACTTGGGAAACTGG - Exonic
1183920237 22:41160711-41160733 CAGTTACTTACGTTTGAGGCTGG - Exonic
953121509 3:40047251-40047273 TAGCAACTTAATGAGGAGGCAGG + Intronic
954303608 3:49714163-49714185 CAGATACTCACTCTGGAGGCTGG - Exonic
954502111 3:51027984-51028006 TAGCTAGTTACTTTGTAGGCTGG + Intronic
962548491 3:136463217-136463239 CAGCTACTTACTGGGCATGCTGG - Intronic
965105626 3:164348469-164348491 CAGCTACTTACCTAGGAATGGGG + Intergenic
967123280 3:186402690-186402712 CAGTTCCCTACTTAGGAAGCTGG - Intergenic
969912241 4:10457306-10457328 CAGCTACTTACCCGGCAGGCCGG + Exonic
970532099 4:16995363-16995385 CATCTACTTGCTGAGGAGACAGG - Intergenic
971524639 4:27601563-27601585 CAGTTATTTACATAGGTGGCTGG + Intergenic
974612282 4:64231805-64231827 CAGCTACTTTCTTAGTAACCTGG - Intergenic
975133124 4:70847938-70847960 AAGCTGCTTACTCAGGAGGCTGG - Intergenic
975573185 4:75838378-75838400 CAGCTACTTACCTAGGAATGGGG - Intergenic
978877519 4:113659592-113659614 CACCTACTTGCTTAGGAAGGAGG + Intronic
988191846 5:27947563-27947585 CAGCTATTCACTTAGGAGTTTGG - Intergenic
989569320 5:42930667-42930689 CAACTAATGAATTAGGAGGCAGG - Intergenic
989579128 5:43015816-43015838 CAACTAATAAATTAGGAGGCAGG - Intergenic
992172896 5:74121803-74121825 CATTTACTTACTGAGGGGGCTGG - Intergenic
997933019 5:138087537-138087559 CAGCCAGCTACTCAGGAGGCTGG + Intronic
998403307 5:141859303-141859325 AAGCGACTTGCTTAGTAGGCAGG - Intronic
999752516 5:154639703-154639725 CACCTACCCACTCAGGAGGCGGG - Intergenic
1000013213 5:157253248-157253270 CAGCTGCTCACACAGGAGGCCGG + Exonic
1000568073 5:162875855-162875877 CAGCTATTTAATTAGAAGCCTGG + Intergenic
1001732305 5:173969368-173969390 CAGAGACTTTCCTAGGAGGCAGG - Intergenic
1003245680 6:4380047-4380069 CATCTCTTTACTTTGGAGGCAGG + Intergenic
1003962571 6:11222466-11222488 CAGCTTCTTAGTTAGAAGACAGG + Intronic
1007321346 6:41030798-41030820 CAGCTTCTTACTCAGGGGGATGG - Intronic
1007735707 6:43981045-43981067 CAGCTACTTGCTTAGGCAGGAGG + Intergenic
1009193581 6:60658618-60658640 CACCTGCCTACTCAGGAGGCAGG + Intergenic
1009823197 6:68831251-68831273 AGGCTACTCACTTAGGCGGCGGG + Intronic
1015865793 6:137725155-137725177 CAGCTCCTGACTTATGAGGGTGG + Intergenic
1016624428 6:146149608-146149630 CAGCTCTTTACTGAGGATGCAGG + Intronic
1016898298 6:149075477-149075499 CAGCCACTTACTTACAAAGCTGG - Exonic
1017921068 6:158872432-158872454 CAGCTAGCTACTCGGGAGGCTGG + Intronic
1020935337 7:14457704-14457726 AAGCTCCTTAATTAGTAGGCTGG + Intronic
1024297705 7:47859133-47859155 CAGCTTGCTACTTAGGAAGCTGG - Intronic
1027182651 7:75951771-75951793 CTGCTGCTTACCAAGGAGGCTGG - Intronic
1027982443 7:85243124-85243146 CAGAGACTTACTTAGGAGAAAGG - Intergenic
1028805674 7:95023663-95023685 CAGCTACTCAGGAAGGAGGCAGG - Intronic
1036382496 8:8246231-8246253 CAGCTACTCACATGGGAGTCAGG - Intergenic
1036388619 8:8305186-8305208 CTGTTCCTTACTAAGGAGGCTGG + Intergenic
1036542227 8:9727523-9727545 CAGCTACTTGGATAGTAGGCAGG - Intronic
1038066303 8:23967160-23967182 CATCTACTTAATAATGAGGCTGG - Intergenic
1041667690 8:60461833-60461855 CAGATTCTGACTTAGGAGGCAGG - Intergenic
1044386123 8:91590840-91590862 TAGCTACTGACTTTGGAGGGTGG + Intergenic
1044389540 8:91633400-91633422 CACCTAATTCCTTAGGATGCTGG - Intergenic
1045016689 8:98006830-98006852 CAGCTAGCTACTCTGGAGGCTGG + Intronic
1048842599 8:138578808-138578830 CAGCCACTTACTCAGCAGGTGGG - Intergenic
1057264579 9:93606089-93606111 CAGCTACTTACTTAGGAGGCTGG - Intronic
1059337627 9:113579188-113579210 CAGCTACTCACTGAGCAGCCAGG - Intronic
1059787134 9:117598147-117598169 CAGCTTCTGCCTGAGGAGGCAGG - Intergenic
1060612593 9:124981765-124981787 GTGCTAGCTACTTAGGAGGCTGG - Intronic
1186319216 X:8405889-8405911 CAGCCACATACTTTGGAGCCTGG - Intergenic
1186784589 X:12945793-12945815 CAGCTACTTACCTAGGAATGGGG + Intergenic
1187991409 X:24877481-24877503 CAGCTACTTAAAAAGGAGGCTGG + Intronic
1190481007 X:50876876-50876898 CAGCTTCTTGCTTATGAGGATGG - Intergenic
1195791598 X:108594140-108594162 CAGCTTCTTACTTAAAAAGCAGG + Intronic
1196293981 X:113978171-113978193 CAGCTATTTACCTAGGAGTGGGG - Intergenic
1198540568 X:137634838-137634860 TAGCTACTTATTTAGGAGTGTGG - Intergenic
1202366959 Y:24172164-24172186 CAGCTCCTTCCTTAGGTGGTTGG - Intergenic
1202373447 Y:24213319-24213341 CAGCTCCTTCCTTAGGTGGTTGG + Intergenic
1202497334 Y:25456801-25456823 CAGCTCCTTCCTTAGGTGGTTGG - Intergenic
1202503823 Y:25497959-25497981 CAGCTCCTTCCTTAGGTGGTTGG + Intergenic