ID: 1057266183

View in Genome Browser
Species Human (GRCh38)
Location 9:93619588-93619610
Sequence GGCCACCAGGAACCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057266183_1057266185 -4 Left 1057266183 9:93619588-93619610 CCTGCTGGTGGTTCCTGGTGGCC 0: 1
1: 0
2: 2
3: 31
4: 215
Right 1057266185 9:93619607-93619629 GGCCTGTGTGCCATGCCTGCTGG No data
1057266183_1057266187 -1 Left 1057266183 9:93619588-93619610 CCTGCTGGTGGTTCCTGGTGGCC 0: 1
1: 0
2: 2
3: 31
4: 215
Right 1057266187 9:93619610-93619632 CTGTGTGCCATGCCTGCTGGTGG No data
1057266183_1057266192 30 Left 1057266183 9:93619588-93619610 CCTGCTGGTGGTTCCTGGTGGCC 0: 1
1: 0
2: 2
3: 31
4: 215
Right 1057266192 9:93619641-93619663 AGCCCGTGCTCCATACCTGCTGG No data
1057266183_1057266189 6 Left 1057266183 9:93619588-93619610 CCTGCTGGTGGTTCCTGGTGGCC 0: 1
1: 0
2: 2
3: 31
4: 215
Right 1057266189 9:93619617-93619639 CCATGCCTGCTGGTGGCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057266183 Original CRISPR GGCCACCAGGAACCACCAGC AGG (reversed) Intronic
900014540 1:138972-138994 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
900044405 1:494174-494196 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
900065812 1:729080-729102 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
901854302 1:12034707-12034729 GGCCATCTGGAGCCATCAGCGGG + Intergenic
902544946 1:17184339-17184361 AGCCACCAGGATCCCCAAGCAGG - Intergenic
906613496 1:47219689-47219711 GGCCACCAGGATCAGCCAGGAGG - Exonic
907277863 1:53327058-53327080 GGCCACCCGGAAGGACCCGCTGG + Intronic
908041606 1:60119643-60119665 GGCCAAAAAGGACCACCAGCAGG - Intergenic
912551742 1:110489496-110489518 TGCCGCCAGGCCCCACCAGCAGG - Intergenic
920499260 1:206476182-206476204 GGCCGGCATGAACCACCTGCGGG + Exonic
920501481 1:206488109-206488131 GGCCTCCAAGAACCACCAGCTGG - Intronic
922733681 1:227968243-227968265 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
924152095 1:241140023-241140045 GGCCATCAGGAACATCCAGCAGG - Intronic
924343861 1:243056546-243056568 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
1064874149 10:19974340-19974362 GGGCCACAGAAACCACCAGCTGG - Intronic
1067728907 10:48794801-48794823 GGCCACCAGGGACTTCCAGGTGG - Intronic
1068575249 10:58676920-58676942 GACCTCCAGCAAACACCAGCAGG + Intronic
1069050120 10:63783501-63783523 TGACCCCAGGAACTACCAGCAGG - Intergenic
1069598363 10:69687204-69687226 GGCCACCAGGACCACCAAGCTGG - Intronic
1069819495 10:71218576-71218598 GAGCACCAGGACCCACCTGCAGG - Intronic
1071749802 10:88461621-88461643 TGCCTCCAGGGACCAACAGCTGG - Intronic
1074379840 10:112970396-112970418 GGCCACCAGGACCCTCCTCCAGG + Intronic
1074455290 10:113590679-113590701 GGCCAAGAGGAGCCAGCAGCTGG - Exonic
1075792574 10:125095514-125095536 GGTCACCAGGCCCCACCACCAGG + Intronic
1076439654 10:130472391-130472413 TAACACCAGGAACCACAAGCTGG - Intergenic
1076684671 10:132192715-132192737 CGCCACCAGGAAGGACCATCAGG - Exonic
1077049144 11:558940-558962 GGTCACCTGGGACCTCCAGCAGG - Exonic
1077222423 11:1423674-1423696 GGGCACCCGGAACGCCCAGCGGG - Intronic
1077222437 11:1423706-1423728 GGGCACCCGGAACGCCCAGCGGG - Intronic
1077222451 11:1423738-1423760 GGGCACCCGGAACGCCCAGCGGG - Intronic
1077222465 11:1423770-1423792 GGGCACCCGGAACGCCCAGCGGG - Intronic
1077222479 11:1423802-1423824 GGGCACCCGGAACGCCCAGCGGG - Intronic
1077463827 11:2724066-2724088 GGCCCCCAGGCACCACCGGAGGG - Intronic
1080973721 11:37309153-37309175 GGCCACCCAGAAACACCAGTGGG - Intergenic
1082261340 11:50078014-50078036 GGCCACCTGGAAGCAGCAGCTGG + Intergenic
1083263746 11:61536741-61536763 GGTCTCCAGGAGCCACCAGAGGG + Intronic
1083472897 11:62896142-62896164 GGCCACCAGGAACTGCCAAGAGG + Intergenic
1083541777 11:63516306-63516328 GGCCACCAGCATGAACCAGCAGG + Exonic
1084067590 11:66714238-66714260 GGGCTCCAGGAACCATGAGCTGG - Intronic
1084095775 11:66910229-66910251 CTCCACCTGGAACCTCCAGCTGG - Intronic
1085777973 11:79383156-79383178 GGCCAACAGAAAGCACTAGCAGG + Intronic
1085972124 11:81605541-81605563 GTGCACCAGGACCCACCAGCTGG - Intergenic
1088826663 11:113500992-113501014 GCCCTCCAGGTGCCACCAGCAGG - Intergenic
1091758470 12:3071773-3071795 GGGCAGCAGGAACCACCATCCGG + Intergenic
1091849136 12:3681083-3681105 GGACACCAGGGGCCTCCAGCAGG - Intronic
1092154513 12:6273756-6273778 AGCCAGCAGGAGGCACCAGCAGG - Intergenic
1094092286 12:26663423-26663445 GGCCACCAGGAACCAATAACAGG + Intronic
1094214162 12:27922912-27922934 AGACAGCAGGAACCAGCAGCAGG + Intergenic
1094247174 12:28311846-28311868 AGCAACCAGGAAACACCAACAGG - Intronic
1099116159 12:78627042-78627064 GGCCACGAGGAGCCAGGAGCAGG + Intergenic
1100325497 12:93536084-93536106 GACCATCAGGAGCCACCACCTGG + Intergenic
1102196440 12:111028826-111028848 GGCCACCAGGTGCCAGCAACAGG + Intergenic
1102804691 12:115769342-115769364 GGCCAATAGGAGGCACCAGCAGG - Intergenic
1103572573 12:121854850-121854872 GGCCACCAGGCAGGAGCAGCAGG - Intronic
1104098672 12:125585278-125585300 GACCACCAGGAACCCCAGGCAGG - Intronic
1108097957 13:46924337-46924359 GGCAACTAGGAAACACCAACAGG - Intergenic
1111459643 13:88522104-88522126 AGCCACCAACAACCACCAGGTGG - Intergenic
1113009737 13:105750285-105750307 GGACACCTGGGACCACCAGAAGG + Intergenic
1113674634 13:112198806-112198828 GGCCACCATGTTCCGCCAGCAGG + Intergenic
1113857978 13:113459360-113459382 GGACACCTGGAACCTCCTGCTGG - Exonic
1114529415 14:23386491-23386513 GGCCAAGCGCAACCACCAGCGGG - Exonic
1116950699 14:50875988-50876010 AGCCAGCAGGAGCCAGCAGCTGG + Intronic
1119777175 14:77256600-77256622 TGGCACCATGAACAACCAGCCGG + Exonic
1121886382 14:97546708-97546730 GGCCACCAGGCCCCGCCAGGCGG + Intergenic
1122114217 14:99519876-99519898 AGCCACCAGCAACCACCGACTGG - Intronic
1122480445 14:102043891-102043913 GGCCAGCAGGAAGTACAAGCGGG - Exonic
1123132389 14:105999409-105999431 GGCACTCAGGAACCACCAGTGGG - Intergenic
1123132497 14:105999803-105999825 GGCGCTCAGGAACCACCAGGGGG - Intergenic
1123154409 14:106210571-106210593 GGCCATCAGGAACGACAGGCTGG - Intergenic
1123203700 14:106692095-106692117 GGGCACTTGGAACCACCAGGGGG - Intergenic
1123716887 15:23040083-23040105 GGCCAGCAGGCACTACTAGCGGG - Intergenic
1128344346 15:66844094-66844116 GTCCAACAGGAAACCCCAGCTGG - Intergenic
1129377775 15:75145067-75145089 GGGCACCAGCAAGCACCAGAGGG - Intergenic
1131212565 15:90510450-90510472 GGCCAACAGGAAGCACTACCAGG + Intergenic
1132593362 16:736436-736458 GGCCACCAGGAATCAGCATAAGG - Intronic
1132789948 16:1680153-1680175 GGCCACCAGGAACCAGAAACCGG - Intronic
1132883379 16:2172028-2172050 GGCCACCAAGAAGGAGCAGCAGG - Intronic
1133295950 16:4752393-4752415 GGCCTCCAGGAGCCACCGGCTGG + Exonic
1135003879 16:18801415-18801437 GGCAGCCAGGACTCACCAGCAGG + Exonic
1136079253 16:27840835-27840857 GGCCGCCAGCCACCGCCAGCCGG + Intronic
1136184100 16:28575144-28575166 TGGCACCAGGATCCACCATCTGG + Intronic
1137984851 16:53099137-53099159 GGCCAGGAGGAACCTGCAGCTGG + Intronic
1139642837 16:68305248-68305270 GGTCACCAGGAAACACCTGTTGG - Intronic
1141092479 16:81139655-81139677 GCCCACCAGGATGCACCACCAGG + Intergenic
1141265105 16:82489537-82489559 GGCCTCCCAGATCCACCAGCTGG + Intergenic
1141979499 16:87541192-87541214 GGCCACCAGGAACCTCCCCTCGG + Intergenic
1142149651 16:88507005-88507027 GGCCACCTGGAAAGGCCAGCAGG - Intronic
1142194871 16:88734742-88734764 GGCCACCACGAGCCACCAGAAGG + Exonic
1142337897 16:89502119-89502141 GGCCACCAGCAGCCACATGCTGG + Intronic
1142449514 16:90166837-90166859 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
1142457579 17:65012-65034 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
1142715595 17:1745387-1745409 GGCAACCAGGTACAACCAGGTGG + Exonic
1142967209 17:3589090-3589112 TGTCACCAGGAGCCACCAGCTGG + Intronic
1142993250 17:3745995-3746017 GGCCACAAGGAACCTCAGGCAGG - Intronic
1144763376 17:17720050-17720072 GGCCACCAGGGACACCCAGGTGG - Intronic
1146726381 17:35159678-35159700 GCCCATCAGGATCCACCAGTGGG + Intronic
1147670529 17:42174405-42174427 GCCCACCAGGCACCATCAGCTGG - Intronic
1148048967 17:44759871-44759893 GTCCGCCAGGAGCCACCAGGGGG + Exonic
1148850449 17:50551977-50551999 GTCCTCCAGGAAGCCCCAGCAGG - Exonic
1148871997 17:50663719-50663741 AGCCACCAGGAAGCCCCACCAGG - Exonic
1149651063 17:58276734-58276756 GACCAGCAGGAACCATCAGGAGG + Intronic
1151911528 17:77086663-77086685 CGCCACCAAGAGCCACCACCAGG + Intergenic
1152749417 17:82055753-82055775 GGCCGCCAGGAAGTACAAGCAGG + Exonic
1154290465 18:13102055-13102077 GGGCACCAGGAACCCCCAGAAGG - Intronic
1154999166 18:21669923-21669945 CGACACCAGGAAGCACCCGCGGG + Intronic
1155927646 18:31673987-31674009 GGCCACCAGGCACCTGAAGCTGG + Intronic
1156649741 18:39211474-39211496 GGGCATCAGGAAGGACCAGCTGG + Intergenic
1157330373 18:46699814-46699836 GCCCTCCAGGAACCTCCACCTGG + Intronic
1158542949 18:58373353-58373375 GACCATCAGAAACAACCAGCAGG + Intronic
1161470416 19:4454243-4454265 GGCCACCTGCAGCCACCAGATGG + Intronic
1162293466 19:9796353-9796375 AGCCACCGGGAACCAGCAGATGG - Intergenic
1163394878 19:17054061-17054083 GGCCACCAGCAGCCACCAGCAGG + Intronic
1163569484 19:18072223-18072245 GGCCACCAGGACCCTGCACCTGG - Exonic
1164570445 19:29371016-29371038 GGCCCCATGGAGCCACCAGCAGG + Intergenic
1164708202 19:30335856-30335878 AGCCACCAAGAACCAGCAGGTGG + Intronic
1166896191 19:46023129-46023151 GGCCAGCAGGAAGTCCCAGCAGG - Intergenic
1167409616 19:49337238-49337260 GGCCACCACCCACCCCCAGCAGG + Intronic
928033338 2:27799700-27799722 GGCCACCAGATTCCACCAACAGG + Intronic
931263260 2:60638445-60638467 GGCCAAGAGGAGGCACCAGCAGG - Intergenic
932472812 2:71973684-71973706 GGCCAAAAGGAAGCATCAGCAGG - Intergenic
934477189 2:94601659-94601681 GGCAACCAGGAACCCACAGCTGG + Intronic
934650967 2:96091247-96091269 GGCAGCCAGGAGCCACCAACAGG + Intergenic
936026611 2:109035528-109035550 TCCAACCAGAAACCACCAGCAGG + Intergenic
938381596 2:130839276-130839298 GGACACCAGGAGGCACCAGGCGG - Intronic
942393542 2:175522213-175522235 GGCCTCCAGCTAACACCAGCGGG - Intergenic
942895469 2:181048007-181048029 GGCCATCAGGAACAAGTAGCAGG - Intronic
943705606 2:191030725-191030747 TTCCACCAGAAACCACCAGAGGG - Intronic
946054229 2:216886943-216886965 GGCCGTCAGGAGTCACCAGCAGG - Intergenic
946177304 2:217929520-217929542 GGCCACAGGGAAGCACCAGCAGG + Intronic
946490474 2:220144579-220144601 CGCCATCAGGAACCACCAAGAGG - Intergenic
948752276 2:240139614-240139636 GGGCACCAGCAGCCACCTGCTGG + Intronic
948894004 2:240919870-240919892 GGCCACCAGGCTCCAGCTGCTGG - Intronic
1170155128 20:13262245-13262267 GGCCACCAGTGGCCACCAGGGGG - Intronic
1171152260 20:22837554-22837576 GAGCTCCAGGAAGCACCAGCAGG - Intergenic
1172781312 20:37438438-37438460 GGCCACTGGGGACCCCCAGCAGG - Intergenic
1174412384 20:50344395-50344417 GGACACCAGGGGCCACCTGCAGG + Intergenic
1175692369 20:61074878-61074900 TGCCATTAGGAACCACCAGCAGG + Intergenic
1176375931 21:6086834-6086856 GGCCACCAGGGAAGACCATCTGG + Intergenic
1176510624 21:7745195-7745217 GGCCGCCAGGCCCCACCTGCGGG + Intronic
1178166417 21:29983301-29983323 CGCAACCAGGAACCACCAATGGG + Intergenic
1178644737 21:34375724-34375746 GGCCGCCAGGCCCCACCTGCGGG + Exonic
1179283143 21:39952068-39952090 GCCCACCAGGAAACCACAGCAGG - Intergenic
1179747544 21:43451410-43451432 GGCCACCAGGGAAGACCATCTGG - Intergenic
1179786974 21:43735611-43735633 GGCTCCCAGGAACCACAGGCTGG - Intronic
1180214526 21:46315916-46315938 GGCCACCTGGAGCCACCCTCTGG + Intronic
1181235527 22:21445846-21445868 GCCCACCAGGCGCCTCCAGCAGG - Exonic
1182083100 22:27543100-27543122 GGCCTCCAGGGACCCCCACCTGG + Intergenic
1182239430 22:28903298-28903320 AGCAACCAGGAACAACAAGCAGG - Intronic
1182797420 22:33000879-33000901 TGCCACCAGGAGCGGCCAGCAGG - Intronic
1183084922 22:35480881-35480903 GGCCACCAGGAACCAGCCCCAGG - Intergenic
1183569242 22:38639861-38639883 GGCCACCAGGACCTACCACCTGG - Intronic
1183672916 22:39283527-39283549 GGCCAGGAGGAATCACCTGCCGG - Intergenic
1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG + Intronic
1183780208 22:39994771-39994793 GGCCTGCAGGGCCCACCAGCCGG - Intergenic
950550381 3:13662584-13662606 GGCCACTAGGAACGGCTAGCCGG - Intergenic
952137257 3:30437192-30437214 TGCCAGCAGCAAGCACCAGCAGG - Intergenic
954139712 3:48598617-48598639 GTCCACCAGGGACCACCAGGGGG + Intergenic
956529300 3:70200169-70200191 GGCCACCATCAGCCACCAGCAGG + Intergenic
957574658 3:81991488-81991510 GGCCAGCAGGAAGCACTATCAGG + Intergenic
959505391 3:107151361-107151383 GGCCTCCAGGAGCCATGAGCAGG - Intergenic
961420793 3:126801549-126801571 AGCAGCCAGGAACCTCCAGCTGG + Intronic
964949471 3:162271234-162271256 GGTCACCTGGAACCTCCAGAGGG + Intergenic
965007635 3:163045273-163045295 GGCCTTCAGGAAACACCAGGGGG + Intergenic
967048540 3:185760567-185760589 GGCCCCTGGCAACCACCAGCTGG + Intronic
968858781 4:3149867-3149889 TGGCAACAGAAACCACCAGCAGG - Intronic
969438274 4:7200930-7200952 GGCCAACAGCCACCACGAGCCGG - Intronic
969595589 4:8147809-8147831 GGTCACCAGTGACCACAAGCTGG - Intronic
979188165 4:117824605-117824627 GGTCACCAGGCACCCCCACCCGG + Intergenic
979258855 4:118631142-118631164 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
979329495 4:119409415-119409437 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
982584529 4:157220849-157220871 GGGCATCAGCAGCCACCAGCAGG + Exonic
983254133 4:165379274-165379296 GGCGCCCAGGAGCCACCCGCAGG - Exonic
986890578 5:12299722-12299744 TGCCACCAGCAACCACCAGGTGG - Intergenic
987333772 5:16880288-16880310 GGCCAACAGGAATCCCCAGAAGG + Intronic
988428939 5:31096467-31096489 GGACACATGGAACCCCCAGCTGG - Intergenic
991668230 5:69021693-69021715 AGCCACCATGCCCCACCAGCTGG - Intergenic
995988427 5:118208135-118208157 GGCCACCAGCCACCAGCCGCCGG - Intergenic
998079378 5:139261939-139261961 GGCCATCAGGTATCAGCAGCAGG + Intronic
999768258 5:154756322-154756344 GGCGACCAGGATCAACCAGGAGG - Intronic
1001149840 5:169217562-169217584 GGCCCCCAGGAACCCCAGGCTGG - Intronic
1001460826 5:171912312-171912334 TGACACCAGGTACCACCAGGGGG + Intronic
1002729438 5:181324755-181324777 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
1005455909 6:26019666-26019688 TGCCGCCAGGTACCACCAGCTGG - Intergenic
1006136730 6:31900453-31900475 GGCCTCCGGGAATCAACAGCAGG + Exonic
1013300867 6:108803854-108803876 GGTCACCAGGGACCTCCATCTGG - Intergenic
1014817663 6:125953221-125953243 GGCCACCTGGCACCAGCAGAGGG - Intergenic
1015219261 6:130785362-130785384 GGCCAGCAGCCACCACAAGCTGG + Intergenic
1017754526 6:157518291-157518313 GCCCAACAGGGACCACCTGCTGG - Intronic
1017788697 6:157776664-157776686 CGCCACCAGGAACCATCACCAGG - Intronic
1018108265 6:160509812-160509834 GGGCACCAGCAGGCACCAGCTGG + Intergenic
1018555279 6:165043066-165043088 GGCCTCCAGGTGCCACCAGGTGG - Intergenic
1020268290 7:6576606-6576628 GGCCACCTGGATCCCCCTGCTGG + Intergenic
1021451193 7:20785118-20785140 GGCCCCCACGTCCCACCAGCTGG + Exonic
1023679271 7:42667530-42667552 GGCCAGCAGGAAGCACCAACAGG - Intergenic
1024073764 7:45808192-45808214 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
1024254283 7:47528269-47528291 GGCCATCAGGGACCATCTGCTGG + Intronic
1025053651 7:55747338-55747360 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
1025131754 7:56377812-56377834 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
1025182550 7:56830891-56830913 GGCCACCAGGAGGCAGCAGTTGG + Intergenic
1025689380 7:63746103-63746125 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
1025864265 7:65365673-65365695 TGCCCCCAGGAAGCACCTGCAGG + Intergenic
1025912280 7:65838695-65838717 GGCCACCTGGAGGCAGCAGCTGG - Intergenic
1025912778 7:65841176-65841198 GGCCACCAGGAGGCAGGAGCTGG - Intergenic
1026660146 7:72293493-72293515 GGCCAAAAGGAGACACCAGCAGG - Intronic
1028484976 7:91347856-91347878 GGCCAACAGGAAGCCCCTGCTGG - Intergenic
1029603879 7:101586774-101586796 GGCCACCAGGACCCAGAAGGCGG - Intergenic
1031109277 7:117586481-117586503 AGCCAACAGGAACCACCAAATGG + Intronic
1032051160 7:128651876-128651898 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
1032780586 7:135162315-135162337 GGCCTCCTGGAAGCCCCAGCAGG - Intronic
1033475163 7:141685428-141685450 AGGCAGCAGGATCCACCAGCTGG - Intronic
1035600182 8:892705-892727 GGAGACCGGGAACCACCAGGCGG + Intergenic
1037644257 8:20775947-20775969 GGCCATTAGAAGCCACCAGCAGG - Intergenic
1037807620 8:22067175-22067197 GGCCACCAGCAACCCCTGGCTGG + Intronic
1040534652 8:48297937-48297959 GGCAACCGGGAAGCACCAACAGG - Intergenic
1041419374 8:57649110-57649132 GGCCAACAGGAGGTACCAGCAGG - Intergenic
1044973862 8:97644649-97644671 GCCCACCAGGATCACCCAGCCGG - Exonic
1044995639 8:97835694-97835716 GGCTCCAAGGCACCACCAGCAGG - Intronic
1045582582 8:103498175-103498197 GACCACCAAGAACAGCCAGCTGG - Intergenic
1049250983 8:141588872-141588894 GGCCTGCAGGCACCACCACCAGG - Intergenic
1049411059 8:142474209-142474231 GGCCACCCCGACCCACCAGAAGG - Intronic
1049542112 8:143213380-143213402 GACCTCCAGGGACCCCCAGCAGG + Intergenic
1052447963 9:28588543-28588565 GGATACCAGGAATCAGCAGCTGG + Intronic
1052852783 9:33387893-33387915 GGCAACCAGGAACCCACAGCTGG - Intronic
1053680883 9:40484434-40484456 GGCAACCAGGAACCCACAGCTGG - Intergenic
1053930871 9:43112748-43112770 GGCAACCAGGAACCCACAGCTGG - Intergenic
1054282830 9:63140501-63140523 GGCAACCAGGAACCCACAGCTGG + Intergenic
1054293965 9:63319949-63319971 GGCAACCAGGAACCCACAGCTGG - Intergenic
1054391990 9:64624438-64624460 GGCAACCAGGAACCCACAGCTGG - Intergenic
1054503739 9:65891890-65891912 GGCAACCAGGAACCCACAGCTGG + Intronic
1055988356 9:82077670-82077692 GGCCACAGGGAACCATCAGTGGG + Intergenic
1057266173 9:93619554-93619576 GGCCACCAGGGGCTACCAGCAGG - Intronic
1057266183 9:93619588-93619610 GGCCACCAGGAACCACCAGCAGG - Intronic
1057266190 9:93619622-93619644 GGCTACCGGAAGCCACCAGCAGG - Intronic
1057266198 9:93619656-93619678 GGCCACGGGGTGCCACCAGCAGG - Intronic
1057445948 9:95114758-95114780 GCCCATGAGGAACCACCTGCAGG + Intronic
1059714986 9:116905254-116905276 TGCTGCCAGGAGCCACCAGCAGG + Intronic
1060011881 9:120050906-120050928 GGCCAGCAGGAGCCAACACCTGG + Intergenic
1060929303 9:127478852-127478874 GGGCACCAGGAACCCCCGGGTGG - Intronic
1061209859 9:129184803-129184825 GCCCACCAGGGAGCACCAGACGG - Intergenic
1061432925 9:130542776-130542798 GGCCTCCAGGATCCTGCAGCTGG + Intergenic
1062283225 9:135761292-135761314 ACCCACCAGGAACCACCATGTGG + Intronic
1062479055 9:136743084-136743106 GGCCAGCAGTGACCACCAGGTGG - Intronic
1203577409 Un_KI270745v1:20024-20046 GGCCACCAGGAGGCAGCAGTTGG - Intergenic
1186411991 X:9352030-9352052 GGCCACAGGGATCCACCTGCTGG + Intergenic
1187563814 X:20428448-20428470 TGCCACAGGGAACCACCATCAGG + Intergenic
1187857691 X:23652858-23652880 AGCCACCAGGAACAACAAGGTGG + Intergenic
1189284271 X:39840481-39840503 CCCCACCAAGGACCACCAGCGGG + Intergenic
1189690572 X:43613199-43613221 GTCCAATAGGTACCACCAGCTGG + Intergenic
1194600841 X:95919618-95919640 GGCAAACAGGAGGCACCAGCAGG + Intergenic