ID: 1057269679

View in Genome Browser
Species Human (GRCh38)
Location 9:93643818-93643840
Sequence GGCCATTTACAGAGGGCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057269679_1057269690 13 Left 1057269679 9:93643818-93643840 CCGTGGGCCCTCTGTAAATGGCC 0: 1
1: 0
2: 3
3: 14
4: 152
Right 1057269690 9:93643854-93643876 CACCACTCACAACAGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057269679 Original CRISPR GGCCATTTACAGAGGGCCCA CGG (reversed) Intronic
900881320 1:5383220-5383242 GGCCATTCCCAGTGGGGCCAGGG - Intergenic
901238880 1:7681532-7681554 GGCCATTTGCACAGGACCCCAGG + Intronic
901684371 1:10935438-10935460 AGCCACTTCCAGAGGCCCCAGGG + Intergenic
902074144 1:13769250-13769272 GGACATTTACAGAGGGGAGATGG - Intronic
902627976 1:17687972-17687994 GGCCATTTCCTGAGCGCCCCAGG - Intronic
902726341 1:18338631-18338653 GGCCATTTCCAGAGGCCTCCGGG + Intronic
907332381 1:53679574-53679596 CCCCATTTACACAGAGCCCAGGG + Intronic
912956040 1:114154526-114154548 GGTCATTTCAAGAGGGCGCAGGG + Intergenic
915517453 1:156421545-156421567 GGCCACTTACATCGAGCCCAGGG + Intronic
918031361 1:180815756-180815778 GGCCATTTACAGTGGGTATAAGG + Intronic
924919464 1:248612360-248612382 GGATGTTTTCAGAGGGCCCAAGG - Intergenic
1064559069 10:16577928-16577950 AGCAATTTAGAGGGGGCCCAGGG + Intergenic
1067292743 10:44956304-44956326 GGCATTTTACAGAGGGCCCAGGG + Intergenic
1069715094 10:70515487-70515509 GGCCATTCACAGATGGCGCCTGG + Intronic
1069959018 10:72068673-72068695 GGCTGATTACAGAGGGACCAAGG - Intronic
1070544153 10:77439622-77439644 GGCCACTTTCAGAGAGCCCATGG - Intronic
1073181596 10:101586992-101587014 GGTCATTCCCTGAGGGCCCAGGG + Intronic
1074217004 10:111394903-111394925 GGCCATTTGCAGATGGCTGATGG + Intergenic
1074983091 10:118635169-118635191 GGGTATTTACAGAGGGCCCTAGG - Intergenic
1076676902 10:132151795-132151817 GGCCATTGTCACAGAGCCCAGGG + Intronic
1076837624 10:133029050-133029072 GGGCATCTGCAGAGGGTCCAAGG + Intergenic
1077115977 11:884839-884861 GGCCATCCAGAGATGGCCCAGGG - Intronic
1077639396 11:3867773-3867795 GGCCATATACACAGAGCCCCTGG + Intronic
1079469658 11:20766179-20766201 GGGCTTTGACAGGGGGCCCAGGG - Intronic
1079624385 11:22598307-22598329 GGCCATTGACACAGGGTTCATGG - Intergenic
1083270572 11:61570162-61570184 GGCCAGATGCAGAGGGCTCAGGG + Intronic
1083319109 11:61834505-61834527 AGCCATTTCCAGAGGGCTCTCGG - Intronic
1084116445 11:67045442-67045464 GGCCATTTATAGAAGGAACACGG + Intronic
1084278688 11:68071502-68071524 GCCCTTTTACAGGAGGCCCATGG + Intronic
1085520857 11:77138201-77138223 GGCCATCTGCTGCGGGCCCATGG - Intronic
1086931951 11:92703452-92703474 TGCCATTTTTTGAGGGCCCATGG - Intronic
1087417161 11:97871740-97871762 GGCTTTTTAAAAAGGGCCCAAGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089534156 11:119150230-119150252 GGCAACTCAGAGAGGGCCCACGG - Intronic
1089603464 11:119628530-119628552 GGCCCTGCCCAGAGGGCCCAGGG - Intronic
1089758712 11:120707136-120707158 GGCCATTTACAGAGGCCTGGAGG + Intronic
1089933190 11:122335136-122335158 GCCCATCTTCTGAGGGCCCAGGG + Intergenic
1092753317 12:11739196-11739218 GGCCCCTTACAGAGGACACAGGG - Intronic
1096257125 12:50070212-50070234 GGGCATACACAGAGGGCCCCTGG - Intronic
1097056560 12:56253572-56253594 GGCCATTTCCACAGGTCCCTTGG + Intronic
1100796275 12:98185131-98185153 GGACATTTACCCAGGGCCCTAGG - Intergenic
1101271390 12:103149446-103149468 GGACATTTACAGAAGGCAAAGGG - Intergenic
1101314186 12:103614271-103614293 TGCCATTGACAGAGGGCTGAAGG + Intronic
1101989058 12:109469536-109469558 GGCCATGTTCAGCGGGCGCATGG - Exonic
1105022654 12:132827923-132827945 AGCCATTTACAGATGACTCATGG - Intronic
1106901774 13:34361133-34361155 GGCCATAAACACAGTGCCCAAGG + Intergenic
1108397020 13:49999291-49999313 GGTGATTTACATAGGGCCCAGGG - Intronic
1112613763 13:100982157-100982179 GGAGACTTAGAGAGGGCCCAAGG + Intergenic
1113874927 13:113588274-113588296 GGCCCTCTACAGAGGCCCCAGGG - Intronic
1114463201 14:22901540-22901562 GTCCATTTCCAGTGGGACCATGG + Exonic
1119179772 14:72597966-72597988 GGCCATTTTAGGAGGGCACAGGG - Intergenic
1122579364 14:102762027-102762049 GCCCATTTCCAGAGGGCCTGAGG + Intergenic
1123150984 14:106181609-106181631 GGCCATTGACAGAGGGGCCGTGG + Intergenic
1123399400 15:19969466-19969488 GGCCATTGACAGAGGGGCCATGG + Intergenic
1123441433 15:20294905-20294927 GGCCAGCTGCAGAGGGCCCGAGG + Intergenic
1123941816 15:25220332-25220354 GCCCAAGAACAGAGGGCCCAGGG - Intergenic
1127966221 15:63924726-63924748 AGCCAGATGCAGAGGGCCCATGG - Intronic
1128823681 15:70687758-70687780 TGGCATTCACAGAGGCCCCATGG + Exonic
1128980377 15:72181082-72181104 TGCCATATACAAAGGCCCCAAGG + Intronic
1129186082 15:73907622-73907644 GGCCATCAGCAGAGGACCCAAGG - Intergenic
1129257729 15:74343626-74343648 CGCCATTTCCAGGGGTCCCAGGG + Intronic
1129767685 15:78180738-78180760 CGGCAGGTACAGAGGGCCCACGG - Exonic
1130179149 15:81607391-81607413 GGCCATGTGGAGAGGGCACAGGG + Intergenic
1130354460 15:83117152-83117174 GGACATTTCCAGATGGACCAGGG + Intronic
1131551519 15:93361183-93361205 GCGCATTTCCAGAGGGACCAGGG + Intergenic
1131829021 15:96342624-96342646 GGGCATTTACAGAGGCCTCCAGG - Intergenic
1132471383 16:105515-105537 GGATATTCACAGAGGGTCCATGG + Intronic
1136035501 16:27536746-27536768 GGCCAGGTACTGAGGGCTCAGGG + Intronic
1137856477 16:51799308-51799330 GACCATTTTCAGAGGGCACAGGG + Intergenic
1137887528 16:52122589-52122611 GGCAGTTTACACAGGGCCCCAGG - Intergenic
1141697730 16:85628064-85628086 GTCCATTCACAGCAGGCCCAGGG + Intronic
1144332726 17:14238465-14238487 AGGCACTTACAGAGGCCCCAGGG + Intergenic
1145878853 17:28339683-28339705 GGCCATGTTCAGTGGGCGCATGG + Exonic
1152270368 17:79321005-79321027 AGCCATTCACAGAGGCCCAAGGG + Intronic
1155318504 18:24595504-24595526 GGCTGCTTTCAGAGGGCCCAGGG - Intergenic
1157810824 18:50694506-50694528 AGCTATTTACAGTGGGCTCATGG + Intronic
1158551998 18:58444262-58444284 GGCGATTTCCAGAGAGCCCTCGG + Intergenic
1160901167 19:1429421-1429443 GCCTAACTACAGAGGGCCCACGG - Intronic
1161533384 19:4803897-4803919 TGCAATTTACAGAGGGACGAGGG + Intergenic
1161994174 19:7702390-7702412 GGCCGATCACAGAGGGCCCTGGG + Intergenic
1162141572 19:8588569-8588591 GGCAAGTGACAGAGAGCCCAGGG - Intronic
1163009957 19:14418930-14418952 GGCCATTTGGAGAGGGACGAGGG - Intronic
1163765832 19:19162763-19162785 GGCCATGCACAGAGAGGCCAGGG + Intronic
1164630264 19:29757513-29757535 GACCACTTAGAGATGGCCCAGGG + Intergenic
1164728576 19:30483775-30483797 GGCCTTTTTCTGAAGGCCCATGG - Intronic
1166339569 19:42129546-42129568 GGCTAAATATAGAGGGCCCAAGG + Intronic
1166396881 19:42447743-42447765 GTCCAATTAGAGAGTGCCCAAGG + Intergenic
1166717374 19:44977212-44977234 GGCCATTTACTGAGTACTCAGGG - Intronic
1166728554 19:45044186-45044208 TGCCATTTATTAAGGGCCCATGG + Intronic
925028294 2:626777-626799 AGCCATCTACAGAGGGACCTCGG + Intergenic
925557884 2:5152482-5152504 GCCCATGCACAGAGGGCACATGG - Intergenic
925767108 2:7246831-7246853 GGCCCTTTACTGTGTGCCCAGGG - Intergenic
931687669 2:64808341-64808363 TGACATTTACATAGGGCCCAGGG - Intergenic
933799659 2:85950596-85950618 GGCCAGTGGCAGAGGGCCAAAGG - Intergenic
940371420 2:152905264-152905286 TGCCATTTAAAAAGGACCCACGG - Intergenic
942206357 2:173623681-173623703 GGCCATTTACAGAGTCACCAAGG + Intergenic
944437554 2:199706415-199706437 GAGCATTAACAGAGTGCCCAAGG - Intergenic
1169201055 20:3710420-3710442 GGCCATTTATGGAGGCCCAAGGG + Intergenic
1169909514 20:10636211-10636233 GCCCCTTTAAAGAGAGCCCAGGG + Intronic
1169911448 20:10650895-10650917 TGCCATTTAAAGAGGGCCCGGGG + Intronic
1174062610 20:47843360-47843382 GGACATACACACAGGGCCCAGGG - Intergenic
1174073025 20:47912138-47912160 GGACATACACACAGGGCCCAGGG + Intergenic
1174151041 20:48486503-48486525 GGACATATACACAGGTCCCAGGG - Intergenic
1174716183 20:52761401-52761423 GTCAATTTACATAGGGCACAGGG - Intergenic
1175527598 20:59646208-59646230 GGACATTTACCCAGGGCCCCAGG - Intronic
1175667534 20:60873099-60873121 GGGCATTTACACAGGGCCCATGG - Intergenic
1179220017 21:39398353-39398375 GGCCATGTAGAGCGTGCCCAGGG + Intronic
1180077091 21:45468431-45468453 GGCCAGCCACAGAGGGCCCAGGG + Exonic
1180201578 21:46228004-46228026 GGCCTCTCAAAGAGGGCCCAAGG + Intronic
1183553456 22:38506827-38506849 CGCCATTCTCAGCGGGCCCAGGG - Intronic
1184059102 22:42071083-42071105 GGCCGCTTACTGAGCGCCCACGG - Intergenic
1184908640 22:47510271-47510293 GGGCATTTACAGTGGACCCCTGG + Intergenic
1184925815 22:47636532-47636554 CTCAATTTACAGAGGACCCAAGG + Intergenic
1184933897 22:47704644-47704666 GGCCATTTATTAAGGGCCGATGG - Intergenic
1184997053 22:48215025-48215047 GGCCAGTCACAGAGGGCTCGGGG + Intergenic
949731174 3:7114933-7114955 GGCCATTTGCAGAGGAGCAAGGG - Intronic
950211133 3:11124429-11124451 TGCCATTTACTGAGGGACCCTGG + Intergenic
952305005 3:32137867-32137889 GATCATTTACAGAGGGGCCATGG + Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
956528652 3:70192422-70192444 TGCCGCTTACACAGGGCCCATGG - Intergenic
957765957 3:84623982-84624004 GGCGATTTTCATAGAGCCCAAGG + Intergenic
959485388 3:106923501-106923523 GGACATTTAGAGAGTGCCTAAGG + Intergenic
959858545 3:111190153-111190175 GGCCAATCACACAGGGCCCCTGG - Intronic
961435660 3:126914907-126914929 GGCCAATTACAGATGACCAATGG - Intronic
962310900 3:134326198-134326220 GGCCACTTCCAGAGGGCCTTGGG + Intergenic
963619849 3:147592877-147592899 GGCCAAGTTCAGAGTGCCCAGGG + Intergenic
966855114 3:184188595-184188617 GCCCATTTCCATAGTGCCCAAGG + Intronic
967685619 3:192412203-192412225 GGCCTTTTATAGGGGGCGCAGGG - Intronic
968136993 3:196226965-196226987 GGCAAGTTCCACAGGGCCCAGGG - Exonic
969352625 4:6606494-6606516 GGGCATGTACAGAGGGGGCATGG - Intronic
971059191 4:22948037-22948059 TGCCAATTACTGAGGTCCCAAGG + Intergenic
972474360 4:39436354-39436376 GGCCATGCACATAGGGGCCAAGG + Intronic
979974618 4:127181679-127181701 GTCTATTTACTGAGTGCCCAAGG + Intergenic
983946413 4:173590757-173590779 GGCCATTTACAGAGGTACAGGGG + Intergenic
985683301 5:1268292-1268314 GGCCATGTCCAGAGGCCTCAGGG - Intronic
985823988 5:2179534-2179556 AGCCATTTACAGAAGGCTCCCGG + Intergenic
990564668 5:57017223-57017245 ATCCAATTACAGAGTGCCCAAGG + Intergenic
997467390 5:134097399-134097421 GGCAACTCACAGAGGGTCCAGGG + Intergenic
1004330364 6:14715458-14715480 TACCTTTCACAGAGGGCCCAAGG + Intergenic
1014838149 6:126183560-126183582 GGCCTTTTAAAGAGGTCCCAGGG + Intergenic
1018092004 6:160353768-160353790 GGCCCTTTTCAGATGGTCCATGG + Intronic
1023709109 7:42973228-42973250 GACCATTTGCAGAGGTCACAGGG - Intergenic
1023879184 7:44308871-44308893 GGCCATGGACAGAGGCCCCGGGG - Intronic
1027497565 7:78907174-78907196 GGCCATTTAAAGAGGGCTTTTGG - Intronic
1030735527 7:113043486-113043508 GGCCATAAACAGGGAGCCCAAGG + Intergenic
1033057362 7:138070677-138070699 TGCCATTTAAACAGGACCCAAGG + Intronic
1039457224 8:37715609-37715631 CGCCACCTACCGAGGGCCCAGGG + Intergenic
1044696209 8:94924659-94924681 GCCCACTTACAGAGTGTCCAGGG - Intronic
1049197210 8:141322508-141322530 GGCAATGGACAGAGGGGCCAGGG - Intergenic
1051344494 9:16139990-16140012 AGCAATTTACAGAGGGTCAAGGG - Intergenic
1057269679 9:93643818-93643840 GGCCATTTACAGAGGGCCCACGG - Intronic
1059652483 9:116327728-116327750 AGCCATTTACTGAGGGCATATGG - Intronic
1060359322 9:122940562-122940584 TGGCATTTACTGAGGGCGCACGG - Intergenic
1061802303 9:133119316-133119338 GACCATTTACCAAGGGCCCAAGG - Intronic
1061862023 9:133473055-133473077 GGCCAGTCAGAGAGGGCCTAGGG + Intronic
1061879841 9:133563055-133563077 GGCAATTTGCCCAGGGCCCATGG - Intronic
1062024182 9:134332832-134332854 GGCCATTCACAGGGGCCCCAAGG - Intronic
1187411179 X:19051710-19051732 GGCCATGTAGAGAGGCCACATGG + Intronic
1189868127 X:45352583-45352605 GGCCTTTCACATAGGCCCCAAGG - Intergenic
1193311094 X:80011786-80011808 GGTGATTATCAGAGGGCCCAGGG - Intergenic
1193656570 X:84205605-84205627 GGGCATTTAGAGAAGGGCCAGGG - Intergenic
1194105555 X:89762723-89762745 GTTGATTTACATAGGGCCCAGGG + Intergenic
1194630949 X:96282936-96282958 GGCTATTTATAAAAGGCCCATGG + Intergenic
1199390997 X:147278838-147278860 GGCCATTTGGAGAGGGCTAAAGG + Intergenic
1200457519 Y:3410548-3410570 GTTGATTTACATAGGGCCCAGGG + Intergenic
1201540375 Y:15099577-15099599 ATCCAATTACAGAGTGCCCAAGG + Intergenic
1201604732 Y:15772207-15772229 AGCCAATTAGAGAGTGCCCAAGG - Intergenic
1202251531 Y:22878346-22878368 CTCCATGTACACAGGGCCCAAGG + Intergenic
1202404519 Y:24512095-24512117 CTCCATGTACACAGGGCCCAAGG + Intergenic
1202466260 Y:25157987-25158009 CTCCATGTACACAGGGCCCAAGG - Intergenic