ID: 1057270453

View in Genome Browser
Species Human (GRCh38)
Location 9:93647381-93647403
Sequence CTGTCCCTGCAGAAGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057270440_1057270453 30 Left 1057270440 9:93647328-93647350 CCTAATCATGCGGGTGGGGCCTG 0: 1
1: 0
2: 2
3: 57
4: 1023
Right 1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG No data
1057270443_1057270453 11 Left 1057270443 9:93647347-93647369 CCTGGTTTTTCCCCTGGCCGTGT 0: 1
1: 0
2: 2
3: 8
4: 136
Right 1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG No data
1057270446_1057270453 -1 Left 1057270446 9:93647359-93647381 CCTGGCCGTGTTCCCTCCACAGC 0: 1
1: 0
2: 2
3: 20
4: 249
Right 1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG No data
1057270447_1057270453 -6 Left 1057270447 9:93647364-93647386 CCGTGTTCCCTCCACAGCTGTCC 0: 1
1: 0
2: 1
3: 41
4: 428
Right 1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG No data
1057270445_1057270453 0 Left 1057270445 9:93647358-93647380 CCCTGGCCGTGTTCCCTCCACAG 0: 1
1: 0
2: 2
3: 13
4: 241
Right 1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG No data
1057270444_1057270453 1 Left 1057270444 9:93647357-93647379 CCCCTGGCCGTGTTCCCTCCACA 0: 1
1: 0
2: 2
3: 22
4: 212
Right 1057270453 9:93647381-93647403 CTGTCCCTGCAGAAGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057270453 Original CRISPR CTGTCCCTGCAGAAGCAGGG AGG Intronic
No off target data available for this crispr