ID: 1057275688

View in Genome Browser
Species Human (GRCh38)
Location 9:93674972-93674994
Sequence GCCTTTCCTTTTCTTCGACC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 167}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057275688_1057275694 16 Left 1057275688 9:93674972-93674994 CCCGGTCGAAGAAAAGGAAAGGC 0: 1
1: 0
2: 4
3: 16
4: 167
Right 1057275694 9:93675011-93675033 ACAGCCCAACAGGTAGTGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 115
1057275688_1057275698 22 Left 1057275688 9:93674972-93674994 CCCGGTCGAAGAAAAGGAAAGGC 0: 1
1: 0
2: 4
3: 16
4: 167
Right 1057275698 9:93675017-93675039 CAACAGGTAGTGCTGGGACAGGG 0: 1
1: 0
2: 0
3: 15
4: 202
1057275688_1057275697 21 Left 1057275688 9:93674972-93674994 CCCGGTCGAAGAAAAGGAAAGGC 0: 1
1: 0
2: 4
3: 16
4: 167
Right 1057275697 9:93675016-93675038 CCAACAGGTAGTGCTGGGACAGG 0: 1
1: 0
2: 0
3: 19
4: 177
1057275688_1057275700 27 Left 1057275688 9:93674972-93674994 CCCGGTCGAAGAAAAGGAAAGGC 0: 1
1: 0
2: 4
3: 16
4: 167
Right 1057275700 9:93675022-93675044 GGTAGTGCTGGGACAGGGGTAGG 0: 1
1: 0
2: 1
3: 60
4: 548
1057275688_1057275703 30 Left 1057275688 9:93674972-93674994 CCCGGTCGAAGAAAAGGAAAGGC 0: 1
1: 0
2: 4
3: 16
4: 167
Right 1057275703 9:93675025-93675047 AGTGCTGGGACAGGGGTAGGGGG 0: 1
1: 0
2: 2
3: 60
4: 594
1057275688_1057275701 28 Left 1057275688 9:93674972-93674994 CCCGGTCGAAGAAAAGGAAAGGC 0: 1
1: 0
2: 4
3: 16
4: 167
Right 1057275701 9:93675023-93675045 GTAGTGCTGGGACAGGGGTAGGG 0: 1
1: 0
2: 2
3: 23
4: 338
1057275688_1057275690 6 Left 1057275688 9:93674972-93674994 CCCGGTCGAAGAAAAGGAAAGGC 0: 1
1: 0
2: 4
3: 16
4: 167
Right 1057275690 9:93675001-93675023 GACGCTCCCTACAGCCCAACAGG 0: 1
1: 0
2: 0
3: 2
4: 64
1057275688_1057275693 15 Left 1057275688 9:93674972-93674994 CCCGGTCGAAGAAAAGGAAAGGC 0: 1
1: 0
2: 4
3: 16
4: 167
Right 1057275693 9:93675010-93675032 TACAGCCCAACAGGTAGTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 79
1057275688_1057275699 23 Left 1057275688 9:93674972-93674994 CCCGGTCGAAGAAAAGGAAAGGC 0: 1
1: 0
2: 4
3: 16
4: 167
Right 1057275699 9:93675018-93675040 AACAGGTAGTGCTGGGACAGGGG 0: 1
1: 0
2: 3
3: 23
4: 241
1057275688_1057275702 29 Left 1057275688 9:93674972-93674994 CCCGGTCGAAGAAAAGGAAAGGC 0: 1
1: 0
2: 4
3: 16
4: 167
Right 1057275702 9:93675024-93675046 TAGTGCTGGGACAGGGGTAGGGG 0: 1
1: 0
2: 1
3: 34
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057275688 Original CRISPR GCCTTTCCTTTTCTTCGACC GGG (reversed) Exonic
907772625 1:57480913-57480935 GCCTTTCTTTTTCTTCGTCAAGG + Intronic
909747377 1:79114071-79114093 GTCTTTGCTTTTCTCTGACCAGG - Intergenic
910232481 1:85000141-85000163 TCTTTTCCTTTTCTTAGACTCGG - Intronic
910469278 1:87534379-87534401 GTCTTTCTTTTTCTTCTACTTGG + Intergenic
912958726 1:114176071-114176093 CCCATTCCTTTTCTTCCACCAGG + Intergenic
916691018 1:167190204-167190226 TGCTTTCCTTTCCTTAGACCTGG + Intergenic
917305303 1:173617974-173617996 GCCTTGGCTTTTCCTCTACCTGG - Intronic
920178969 1:204120848-204120870 GCCTTTCCTTCTTCTCGACATGG - Intronic
922291533 1:224212824-224212846 GCCTTTCATCTTCTTCAACCTGG + Intergenic
922810211 1:228411095-228411117 GCCTCTGCTCTTCTTCCACCAGG + Exonic
923923883 1:238601466-238601488 GCCTTTCCTTTACTTCCACATGG + Intergenic
1065746933 10:28850692-28850714 GTCTTTCCGTTTCTTCATCCAGG + Intronic
1065821009 10:29525657-29525679 GGCTTTCCTTCTCTTCTAGCTGG - Intronic
1066058273 10:31701061-31701083 TTCTTTCCTTCTCTTTGACCTGG + Intergenic
1066211411 10:33242877-33242899 GCCTTTTCTTTTCTTCTTTCTGG + Intronic
1067841803 10:49686972-49686994 GCCTCACCTTTTCTCTGACCTGG - Intronic
1069253927 10:66308993-66309015 GCCTTTGCATTTCTTCTACTTGG + Intronic
1070861351 10:79666356-79666378 TCCTTTCCTTTTCTACACCCTGG + Intergenic
1075585404 10:123653689-123653711 TCCTTTCCTTTCCTTCCAACAGG - Intergenic
1075857474 10:125642179-125642201 GCATTTTCTTTTCTTCTCCCAGG - Intronic
1076470409 10:130714423-130714445 CCCTTTCCTTTTTGTCCACCCGG + Intergenic
1077138228 11:1012208-1012230 GCCTTTATTTTTCTTTGACGAGG - Exonic
1077845127 11:6015085-6015107 GGCTTTCCTTTTCTACCACATGG - Intergenic
1081232691 11:40605603-40605625 GTCTTTTCTTTTCTTCCCCCAGG - Intronic
1083397253 11:62400393-62400415 GCCGTTCCTTTTCTGAGCCCTGG + Intergenic
1085452463 11:76643179-76643201 GGCTTTCCTTTCCCTCAACCTGG + Intergenic
1085818780 11:79770374-79770396 GGCTTTTCTTTTCTACCACCTGG - Intergenic
1087237975 11:95741511-95741533 GCCTTCCCTTTTCTTCATCCTGG + Intergenic
1087241687 11:95789026-95789048 GTCTGTCCTCTTCTTCCACCAGG - Intronic
1087686470 11:101271511-101271533 GTAGTTCCTTTTCTTTGACCAGG - Intergenic
1089220929 11:116870881-116870903 GCCTTCTCTTTTCTTCTGCCTGG - Intronic
1089521567 11:119067847-119067869 GCGCTTCGTTTTCTTCGACAAGG + Exonic
1090490919 11:127159916-127159938 GGCTTTCCTTTTCTGCTACATGG + Intergenic
1091022917 11:132116921-132116943 CCCCTTACTTTTCTTCGACCTGG - Intronic
1091280518 11:134379343-134379365 CCCTTTCCTTTTCCTCCACTTGG + Intronic
1092210847 12:6645574-6645596 GCCCTTACGTTTCTTCGAACAGG - Intronic
1096159879 12:49367503-49367525 TCCTTTCCTCTTCTCAGACCCGG + Exonic
1097627837 12:62022162-62022184 GCCTTTCCTTTACACCAACCAGG - Intronic
1099066953 12:77992840-77992862 GCCTCTCCTATTCATAGACCAGG - Intronic
1099898699 12:88681223-88681245 GGCTTTCCTTTTCTACCACGTGG - Intergenic
1100020309 12:90061356-90061378 GCTTTTACTTTTCTTTGACTGGG + Intergenic
1103125140 12:118415455-118415477 AGCTTTCCTTGTCTTCAACCTGG - Exonic
1113313472 13:109154943-109154965 CCCTTTCCTTTTCTTGTACTTGG - Intronic
1113840996 13:113361436-113361458 TGCTGTCCTTTTCTTCGACCAGG - Intronic
1114140907 14:19909433-19909455 AGCTTTACTCTTCTTCGACCTGG - Intergenic
1115351458 14:32400003-32400025 GCTTCTTCTTTTCTTCCACCAGG + Intronic
1118968474 14:70610774-70610796 CCCTTTCCCTTTCCTCTACCAGG - Intergenic
1119139695 14:72255137-72255159 GCCTTTCCTTTTCCTTTCCCTGG - Intronic
1119544752 14:75463559-75463581 GCCTTTCCTTAGCCTAGACCAGG - Intronic
1120377694 14:83730275-83730297 GCCTTTTCTTTTCTTCCACATGG + Intergenic
1126490700 15:49232539-49232561 GCCTTTTCTTTTCTACCACATGG + Intronic
1127393919 15:58528513-58528535 GCCTTTTTTTTTCTTTGACAGGG + Intronic
1127723423 15:61724910-61724932 AACTTTCCTTTTCTTCAATCAGG - Intergenic
1128310140 15:66625592-66625614 GCATTTCCTCTTCTTTGACATGG - Intronic
1130213932 15:81951195-81951217 GCCTTTCCTCTTCCTGGTCCTGG + Intergenic
1132228089 15:100159355-100159377 GCTTTTTATTTTCTTCTACCTGG + Intronic
1134049347 16:11126058-11126080 GCCTTTCCGCTTCTACGACCAGG + Exonic
1134754831 16:16657866-16657888 TCCTTTTCTTTTCTTTGACATGG + Intergenic
1134991230 16:18701267-18701289 TCCTTTTCTTTTCTTTGACATGG - Intergenic
1135520881 16:23177156-23177178 GACTTTCCTTGTCTTCAACAAGG + Intergenic
1137862016 16:51856230-51856252 GCCCTTCCTTTTCTTAGAAAAGG + Intergenic
1138329380 16:56201274-56201296 GGCATTCCTTTTTTTCGACCTGG - Intronic
1140985527 16:80154923-80154945 GCCTTCTCTTTCCTTCCACCAGG + Intergenic
1141450567 16:84098162-84098184 GCTTTTCCTTTTCTTCTCCAGGG - Intronic
1141946463 16:87313719-87313741 GCCTTTCCTTTTTTGAGACCGGG - Intronic
1146427557 17:32756786-32756808 GCTTTTCCTTTACTTCCACAAGG + Intronic
1147462492 17:40582326-40582348 TCCTTCCCTTTTCTTCATCCTGG - Intergenic
1147894577 17:43742167-43742189 GCCTTTTTTTTTCTTAGACAGGG + Intergenic
1148778367 17:50108484-50108506 GGCTTTCCTTTTCTCCTACATGG + Intronic
1150476495 17:65479766-65479788 GCCTTTGCTTATCTTTGCCCTGG + Intergenic
1152656129 17:81519924-81519946 TCCTTTCCTTTTCTGGGAGCTGG - Intronic
1154411955 18:14146426-14146448 GGGTTTCCTTTTCTGCGAGCCGG + Intergenic
1157347804 18:46855678-46855700 GCTTTTCCTTTTTTTCCTCCTGG - Intronic
1159575836 18:70175933-70175955 GCCTTTCCTTCTCTTCAGCTAGG - Intronic
1160089195 18:75810011-75810033 GCCTTTCCTCTGCTTTGACTGGG + Intergenic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1162497397 19:11030912-11030934 CCCCTTCCTTCTCCTCGACCTGG - Intronic
1163703325 19:18798056-18798078 GCCTTTCCTTTTCTTGAGACAGG - Intergenic
1167441414 19:49511487-49511509 TCCTTTCCTTTTTTTTGACAGGG - Intronic
1167615459 19:50530451-50530473 GCCCTTCCCTTTCATCCACCGGG + Intronic
931308913 2:61059851-61059873 GACTTTCCTATTCTTCTAACAGG - Intergenic
931446262 2:62329891-62329913 GCCTTCCCTTTCCTTAGCCCGGG + Intergenic
931848555 2:66230284-66230306 GCTTTTTCTTTTCTTTGACATGG - Intergenic
931972624 2:67606144-67606166 GCATTTCATTTTCTTCAACTTGG - Intergenic
935293358 2:101627986-101628008 GCATTTCCTGGTCTTTGACCAGG + Intergenic
936431244 2:112465451-112465473 ACCTTTCCTTTTCTTTCTCCAGG - Intergenic
938420069 2:131138666-131138688 GCCTTTCCTCTTCTCAGACAGGG - Intronic
938749387 2:134314348-134314370 GCCTTTCCTCTTCCTCAAACTGG - Intronic
942598434 2:177615669-177615691 GCCTTTCTTTTTTTATGACCTGG - Exonic
943584706 2:189724486-189724508 GCCTTTCCTTTTGTTCGACAAGG + Intronic
946818405 2:223604938-223604960 GCCTTTGCTTTTCTTAGACCAGG - Intergenic
948332972 2:237184672-237184694 GACTTTCTTTTTCTGAGACCAGG + Intergenic
948834599 2:240620069-240620091 GCTTTCCCTTTTCTTGGCCCTGG - Intronic
948953159 2:241268152-241268174 GCCTTAACTTTTCTTCAACTTGG - Intronic
1168756094 20:318942-318964 GCCTTTTTTTTTTTTCGACAAGG - Intergenic
1169825086 20:9758874-9758896 GCCTTTCTTTTCCTTAGACATGG - Intronic
1173512360 20:43640155-43640177 GCCTTTTCTTTTCTGAGACAGGG - Intronic
1174511639 20:51057917-51057939 CCCCTTGCTTTTCTTCCACCAGG + Intergenic
1174524925 20:51163205-51163227 GCCTTCCCTTGTCTTCCACCTGG - Intergenic
1176522233 21:7833218-7833240 GCCTTTTTTTTTCTTAGACAAGG + Intergenic
1178656253 21:34463230-34463252 GCCTTTTTTTTTCTTAGACAAGG + Intergenic
1179109608 21:38435045-38435067 GCCTTTCCATTTCTTCCATGTGG - Intronic
1184318571 22:43720203-43720225 TCCTTTCCTTTCCTTGAACCCGG - Intronic
951241265 3:20288386-20288408 GGCTTTCCTTTTCTACCACCTGG + Intergenic
957136660 3:76296974-76296996 GCCTTCCCTTTTCATAAACCAGG - Intronic
958054157 3:88387630-88387652 TCTTTTCCTTTTCTTCCACCTGG + Intergenic
962285800 3:134084783-134084805 GCCTTTCCTTTCCTCTTACCTGG - Intronic
963107059 3:141656452-141656474 TCCTTTCCTTTTCTTCTCTCAGG + Intergenic
963783790 3:149512814-149512836 GCTTTTCCTTCTCTTGGCCCAGG - Intergenic
963854833 3:150242784-150242806 ACCTTTCCCCTTCTTAGACCTGG - Intergenic
964152695 3:153547043-153547065 TCCTTTCCTTTTCTTAGATAAGG - Intergenic
964530587 3:157663474-157663496 GCTTTTCCTTTTCTTGGAAAAGG - Intronic
964545485 3:157829040-157829062 GCCTTTTCTTTTCTACCACATGG + Intergenic
966589091 3:181660162-181660184 GTCTTTTCTTTTCTTTGACAGGG - Intergenic
970199392 4:13587753-13587775 GCCTTTCTTCCTCTTCAACCTGG + Exonic
970365003 4:15349699-15349721 TCCTTTTCTTTTCCTTGACCCGG + Intronic
970549826 4:17167962-17167984 GCCTTTCCCCTTCTTCGGCTAGG - Intergenic
970814160 4:20134225-20134247 GCCTTTCCTCTTATTTGTCCTGG - Intergenic
977519871 4:98068259-98068281 TCTTTTCCTTTTCTTTGACTAGG + Intronic
978927610 4:114268090-114268112 GCCTCTCCTCTTCTTCTCCCTGG + Intergenic
980044515 4:127973018-127973040 TTCTTTTCTTTTCTTAGACCGGG + Intronic
980458226 4:133072892-133072914 GATTTTTCTTTTCTTCCACCTGG - Intergenic
980915600 4:139030553-139030575 GGCTCTCCTTTTCTTATACCTGG - Intronic
982715700 4:158805236-158805258 TCTTTTCCTTTTCTTAGTCCTGG - Intronic
985176403 4:187207725-187207747 CCCTTTCCTTTTTTTCCACAGGG + Intergenic
989376551 5:40769186-40769208 AACTTTCCATTTCTTCCACCTGG + Intronic
990625465 5:57605505-57605527 GCCTTTCCCTTTCTCTGTCCTGG + Intergenic
992621260 5:78595517-78595539 TCCTTTCCTTTTTTTAGACAGGG + Intronic
994549238 5:101209256-101209278 GGCTTTCCTTTTCTTAGATGAGG + Intergenic
996353491 5:122571868-122571890 TCCTCTCCTTTTGTTCTACCTGG - Intergenic
997773463 5:136575977-136575999 CCCTTTCCTATACTTCCACCTGG - Intergenic
1000463484 5:161548457-161548479 GCCTTTCCAGTTCTTCACCCAGG - Intronic
1000952016 5:167496016-167496038 GCCTTTCCTTTGCTTGCACTAGG - Intronic
1000988635 5:167888713-167888735 GCCTTTCCTTTGATTCCCCCAGG + Intronic
1002257992 5:177973287-177973309 AGCTTTCCTTGTCTTCAACCTGG - Intergenic
1002382578 5:178840913-178840935 GCCTTTCCTTCTCCTCCTCCAGG - Intergenic
1002777709 6:342806-342828 GCCTTTCCATTGCTTCAACATGG + Intronic
1002794103 6:456802-456824 GCCTTTGCTTTTCTACCACATGG + Intergenic
1004352841 6:14905378-14905400 GCCCTTCCATTCCTTCCACCAGG + Intergenic
1006674585 6:35753178-35753200 GCCTTCCCTCTTCTTCCAACTGG + Intergenic
1007657403 6:43459142-43459164 TCCTTTCCTTTTCTTTGAGATGG - Intergenic
1007774263 6:44216099-44216121 GCCTCTACTTTTCTTCCCCCAGG + Intergenic
1008252912 6:49262763-49262785 GCCTTTCCTTCTCTTCCACCAGG - Intergenic
1008259833 6:49351350-49351372 GCTTTTTCTTTTCTTTGAGCCGG - Intergenic
1008408368 6:51144275-51144297 GCCTTTCCTTTTCTTCCAGCAGG - Intergenic
1013224850 6:108113617-108113639 AACTTTCGTTTTCTTCCACCAGG + Intronic
1015428617 6:133103020-133103042 GCCTTTGCATCTCTTCCACCAGG - Intergenic
1016168824 6:140982484-140982506 GGCTTTGCTTTTCTTGGACTTGG + Intergenic
1018255687 6:161916696-161916718 GGCTTTCCTCTTCTTCTACCCGG + Intronic
1019338365 7:495606-495628 GTGTTTCCTTTTCTTCACCCAGG - Intergenic
1022328930 7:29359536-29359558 TCCTTTCCTTTTCTTAGAAAAGG + Intronic
1024117992 7:46210968-46210990 GACTTTCCTCTCCTTAGACCAGG - Intergenic
1024143783 7:46489861-46489883 GCCTTTCCAATTCTTTGAGCTGG + Intergenic
1025087294 7:56033890-56033912 GACTTTCCTTTTCCTCTTCCAGG - Intronic
1025899332 7:65731496-65731518 GACTTTCCTTTTCCTCTTCCAGG - Intergenic
1028705561 7:93840883-93840905 ACATTTCCTTTTCTTCAACCAGG + Intronic
1029480536 7:100809816-100809838 CCCTTTCTGTCTCTTCGACCAGG + Intronic
1031618310 7:123906078-123906100 GGCTTTTCTTTTCTACCACCTGG + Intergenic
1034498520 7:151435811-151435833 GCCTTTGGTTTTCTTGAACCGGG - Intronic
1035111479 7:156485945-156485967 GCCATTTCTTTTCTTCAAGCAGG + Intergenic
1037142087 8:15532203-15532225 GCCTTTCTTTTTCTGGGACTTGG + Intronic
1038552220 8:28480113-28480135 GCCTTTCCTTTTGTTTCTCCTGG + Intronic
1043255239 8:78127760-78127782 TCCTTTGCTTTTCTTCCATCAGG - Intergenic
1047692742 8:127372959-127372981 GCCTTTGCTTTTCCTCTGCCTGG - Intergenic
1048659364 8:136578918-136578940 GCCTTTCATTTTCTGAGATCAGG - Intergenic
1051758593 9:20434683-20434705 GCCTTTCCTTTTATTAGAAAAGG - Intronic
1053051101 9:34961045-34961067 GCCATTCCTTTCCTTCAACATGG + Intronic
1055552294 9:77442705-77442727 GAGTTTCCTTTTCTTCTGCCAGG - Intronic
1056188455 9:84160836-84160858 CTTTTTCCTTTTCTTCTACCAGG + Intergenic
1057275688 9:93674972-93674994 GCCTTTCCTTTTCTTCGACCGGG - Exonic
1058686981 9:107488435-107488457 GCATCACCTCTTCTTCGACCCGG - Intronic
1058881424 9:109288890-109288912 TCCTTTCCTTTTTTTTGACAAGG - Intronic
1058886952 9:109329052-109329074 TCCTTTCCTTTTCTTTTAACTGG + Intergenic
1185493482 X:537026-537048 ACGTTTCGTTTTCATCGACCGGG - Intergenic
1186215776 X:7299611-7299633 GCTTTGCCTTTTCTTCTACAAGG - Intronic
1187668582 X:21644623-21644645 GCATTTCCCCTTCTTCTACCTGG - Intronic
1188916737 X:35920282-35920304 GCCTCCCCATTTCTTCAACCTGG + Intronic
1189292860 X:39898019-39898041 GGCATTCCTTTTCTACTACCAGG - Intergenic
1191738058 X:64407862-64407884 GGCTTTTCTTTTCTTCCACGTGG + Intergenic
1192757875 X:74065746-74065768 TCCTTTCCTTTTCTCCGAAAGGG + Intergenic
1194097724 X:89664084-89664106 GTCTTTCCTTTTCTTAGTCTGGG + Intergenic
1195498280 X:105563741-105563763 GTCTTTCTTTTTCTTCTCCCTGG - Intronic
1197048205 X:122026104-122026126 AACTTTCTTTTTCTTCCACCTGG - Intergenic
1197375762 X:125680426-125680448 GCTTTTTCTTTTCTTCCAGCTGG - Intergenic
1197652287 X:129078435-129078457 CCCTTTCCTTTTCCTCTAGCTGG + Intergenic
1198722339 X:139636262-139636284 GCCTTTCCTTTTTCTTCACCTGG + Intronic
1199659707 X:150036723-150036745 GTCTTTCCTTTTGTTTCACCAGG - Intergenic
1200450745 Y:3325457-3325479 GTCTTTCCTTTTCTTAGTCTGGG + Intergenic