ID: 1057277612

View in Genome Browser
Species Human (GRCh38)
Location 9:93684361-93684383
Sequence CTTGCCAGGGGGCATCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057277612_1057277626 26 Left 1057277612 9:93684361-93684383 CCTGATGGATGCCCCCTGGCAAG No data
Right 1057277626 9:93684410-93684432 TTGCCCTTGAACCCTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057277612 Original CRISPR CTTGCCAGGGGGCATCCATC AGG (reversed) Intergenic