ID: 1057283085

View in Genome Browser
Species Human (GRCh38)
Location 9:93726753-93726775
Sequence TATGATTCACAGAGGGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057283085_1057283091 2 Left 1057283085 9:93726753-93726775 CCTCAGGCCCTCTGTGAATCATA No data
Right 1057283091 9:93726778-93726800 AGTCCTCGAGACTGGGCTACGGG No data
1057283085_1057283089 -5 Left 1057283085 9:93726753-93726775 CCTCAGGCCCTCTGTGAATCATA No data
Right 1057283089 9:93726771-93726793 TCATACAAGTCCTCGAGACTGGG No data
1057283085_1057283090 1 Left 1057283085 9:93726753-93726775 CCTCAGGCCCTCTGTGAATCATA No data
Right 1057283090 9:93726777-93726799 AAGTCCTCGAGACTGGGCTACGG No data
1057283085_1057283095 29 Left 1057283085 9:93726753-93726775 CCTCAGGCCCTCTGTGAATCATA No data
Right 1057283095 9:93726805-93726827 TGTGAGACCTGAGAAGACCCTGG No data
1057283085_1057283088 -6 Left 1057283085 9:93726753-93726775 CCTCAGGCCCTCTGTGAATCATA No data
Right 1057283088 9:93726770-93726792 ATCATACAAGTCCTCGAGACTGG No data
1057283085_1057283092 3 Left 1057283085 9:93726753-93726775 CCTCAGGCCCTCTGTGAATCATA No data
Right 1057283092 9:93726779-93726801 GTCCTCGAGACTGGGCTACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057283085 Original CRISPR TATGATTCACAGAGGGCCTG AGG (reversed) Intergenic
No off target data available for this crispr