ID: 1057285435

View in Genome Browser
Species Human (GRCh38)
Location 9:93749742-93749764
Sequence CAAACTGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057285435_1057285438 4 Left 1057285435 9:93749742-93749764 CCCATATCACTATCAGCAGTTTG No data
Right 1057285438 9:93749769-93749791 AAGCCATTCAACAAGTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057285435 Original CRISPR CAAACTGCTGATAGTGATAT GGG (reversed) Intergenic