ID: 1057285438

View in Genome Browser
Species Human (GRCh38)
Location 9:93749769-93749791
Sequence AAGCCATTCAACAAGTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057285435_1057285438 4 Left 1057285435 9:93749742-93749764 CCCATATCACTATCAGCAGTTTG No data
Right 1057285438 9:93749769-93749791 AAGCCATTCAACAAGTATCTAGG No data
1057285432_1057285438 27 Left 1057285432 9:93749719-93749741 CCACCTCAGCCTGAACTTCATTG No data
Right 1057285438 9:93749769-93749791 AAGCCATTCAACAAGTATCTAGG No data
1057285436_1057285438 3 Left 1057285436 9:93749743-93749765 CCATATCACTATCAGCAGTTTGG No data
Right 1057285438 9:93749769-93749791 AAGCCATTCAACAAGTATCTAGG No data
1057285434_1057285438 18 Left 1057285434 9:93749728-93749750 CCTGAACTTCATTGCCCATATCA No data
Right 1057285438 9:93749769-93749791 AAGCCATTCAACAAGTATCTAGG No data
1057285433_1057285438 24 Left 1057285433 9:93749722-93749744 CCTCAGCCTGAACTTCATTGCCC No data
Right 1057285438 9:93749769-93749791 AAGCCATTCAACAAGTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057285438 Original CRISPR AAGCCATTCAACAAGTATCT AGG Intergenic