ID: 1057287697

View in Genome Browser
Species Human (GRCh38)
Location 9:93773488-93773510
Sequence ATTTTAAAGGGGATCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057287686_1057287697 13 Left 1057287686 9:93773452-93773474 CCTCAAATCCATTTCTGTGAGGA No data
Right 1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG No data
1057287688_1057287697 5 Left 1057287688 9:93773460-93773482 CCATTTCTGTGAGGAGTTCTGGG No data
Right 1057287697 9:93773488-93773510 ATTTTAAAGGGGATCATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057287697 Original CRISPR ATTTTAAAGGGGATCATGGA GGG Intergenic
No off target data available for this crispr