ID: 1057287762

View in Genome Browser
Species Human (GRCh38)
Location 9:93774223-93774245
Sequence CAGCACAGACACTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057287757_1057287762 20 Left 1057287757 9:93774180-93774202 CCAACCATCTCAGCAGAAGCCAG No data
Right 1057287762 9:93774223-93774245 CAGCACAGACACTGCCATCTTGG No data
1057287760_1057287762 1 Left 1057287760 9:93774199-93774221 CCAGGAGTAGAGATGAGATTATT No data
Right 1057287762 9:93774223-93774245 CAGCACAGACACTGCCATCTTGG No data
1057287759_1057287762 16 Left 1057287759 9:93774184-93774206 CCATCTCAGCAGAAGCCAGGAGT No data
Right 1057287762 9:93774223-93774245 CAGCACAGACACTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057287762 Original CRISPR CAGCACAGACACTGCCATCT TGG Intergenic
No off target data available for this crispr