ID: 1057290894

View in Genome Browser
Species Human (GRCh38)
Location 9:93806897-93806919
Sequence CTGAGGTGCTGTGTGACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057290891_1057290894 9 Left 1057290891 9:93806865-93806887 CCTATGGCTCTAGGAAGGGGGTC No data
Right 1057290894 9:93806897-93806919 CTGAGGTGCTGTGTGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057290894 Original CRISPR CTGAGGTGCTGTGTGACCCC TGG Intergenic