ID: 1057294249 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:93826322-93826344 |
Sequence | AACCGGAACGGGAATGGTGG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1057294249_1057294256 | 3 | Left | 1057294249 | 9:93826322-93826344 | CCGCCACCATTCCCGTTCCGGTT | No data | ||
Right | 1057294256 | 9:93826348-93826370 | GAACACAATGCACCGCGCACAGG | No data | ||||
1057294249_1057294258 | 22 | Left | 1057294249 | 9:93826322-93826344 | CCGCCACCATTCCCGTTCCGGTT | No data | ||
Right | 1057294258 | 9:93826367-93826389 | CAGGCTGTGCCAAAGTCCACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1057294249 | Original CRISPR | AACCGGAACGGGAATGGTGG CGG (reversed) | Intergenic | ||