ID: 1057294249

View in Genome Browser
Species Human (GRCh38)
Location 9:93826322-93826344
Sequence AACCGGAACGGGAATGGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057294249_1057294256 3 Left 1057294249 9:93826322-93826344 CCGCCACCATTCCCGTTCCGGTT No data
Right 1057294256 9:93826348-93826370 GAACACAATGCACCGCGCACAGG No data
1057294249_1057294258 22 Left 1057294249 9:93826322-93826344 CCGCCACCATTCCCGTTCCGGTT No data
Right 1057294258 9:93826367-93826389 CAGGCTGTGCCAAAGTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057294249 Original CRISPR AACCGGAACGGGAATGGTGG CGG (reversed) Intergenic