ID: 1057294256

View in Genome Browser
Species Human (GRCh38)
Location 9:93826348-93826370
Sequence GAACACAATGCACCGCGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057294251_1057294256 0 Left 1057294251 9:93826325-93826347 CCACCATTCCCGTTCCGGTTGGA No data
Right 1057294256 9:93826348-93826370 GAACACAATGCACCGCGCACAGG No data
1057294246_1057294256 12 Left 1057294246 9:93826313-93826335 CCTTCGCCGCCGCCACCATTCCC No data
Right 1057294256 9:93826348-93826370 GAACACAATGCACCGCGCACAGG No data
1057294253_1057294256 -8 Left 1057294253 9:93826333-93826355 CCCGTTCCGGTTGGAGAACACAA No data
Right 1057294256 9:93826348-93826370 GAACACAATGCACCGCGCACAGG No data
1057294254_1057294256 -9 Left 1057294254 9:93826334-93826356 CCGTTCCGGTTGGAGAACACAAT No data
Right 1057294256 9:93826348-93826370 GAACACAATGCACCGCGCACAGG No data
1057294247_1057294256 6 Left 1057294247 9:93826319-93826341 CCGCCGCCACCATTCCCGTTCCG No data
Right 1057294256 9:93826348-93826370 GAACACAATGCACCGCGCACAGG No data
1057294252_1057294256 -3 Left 1057294252 9:93826328-93826350 CCATTCCCGTTCCGGTTGGAGAA No data
Right 1057294256 9:93826348-93826370 GAACACAATGCACCGCGCACAGG No data
1057294249_1057294256 3 Left 1057294249 9:93826322-93826344 CCGCCACCATTCCCGTTCCGGTT No data
Right 1057294256 9:93826348-93826370 GAACACAATGCACCGCGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057294256 Original CRISPR GAACACAATGCACCGCGCAC AGG Intergenic