ID: 1057294648

View in Genome Browser
Species Human (GRCh38)
Location 9:93828058-93828080
Sequence CGCCCGCCCTGGGCCGCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057294648_1057294663 22 Left 1057294648 9:93828058-93828080 CCGCTGGCGGCCCAGGGCGGGCG No data
Right 1057294663 9:93828103-93828125 GAGGCTGCCATCACATTCCTGGG No data
1057294648_1057294659 3 Left 1057294648 9:93828058-93828080 CCGCTGGCGGCCCAGGGCGGGCG No data
Right 1057294659 9:93828084-93828106 GGGCAGGGGGCCATCTGCCGAGG No data
1057294648_1057294662 21 Left 1057294648 9:93828058-93828080 CCGCTGGCGGCCCAGGGCGGGCG No data
Right 1057294662 9:93828102-93828124 CGAGGCTGCCATCACATTCCTGG No data
1057294648_1057294664 23 Left 1057294648 9:93828058-93828080 CCGCTGGCGGCCCAGGGCGGGCG No data
Right 1057294664 9:93828104-93828126 AGGCTGCCATCACATTCCTGGGG No data
1057294648_1057294658 -10 Left 1057294648 9:93828058-93828080 CCGCTGGCGGCCCAGGGCGGGCG No data
Right 1057294658 9:93828071-93828093 AGGGCGGGCGGGCGGGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057294648 Original CRISPR CGCCCGCCCTGGGCCGCCAG CGG (reversed) Intergenic
No off target data available for this crispr