ID: 1057294658

View in Genome Browser
Species Human (GRCh38)
Location 9:93828071-93828093
Sequence AGGGCGGGCGGGCGGGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057294648_1057294658 -10 Left 1057294648 9:93828058-93828080 CCGCTGGCGGCCCAGGGCGGGCG No data
Right 1057294658 9:93828071-93828093 AGGGCGGGCGGGCGGGCAGGGGG No data
1057294640_1057294658 18 Left 1057294640 9:93828030-93828052 CCATTATTAATGTAGTGTAAATA No data
Right 1057294658 9:93828071-93828093 AGGGCGGGCGGGCGGGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057294658 Original CRISPR AGGGCGGGCGGGCGGGCAGG GGG Intergenic