ID: 1057294659

View in Genome Browser
Species Human (GRCh38)
Location 9:93828084-93828106
Sequence GGGCAGGGGGCCATCTGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057294648_1057294659 3 Left 1057294648 9:93828058-93828080 CCGCTGGCGGCCCAGGGCGGGCG No data
Right 1057294659 9:93828084-93828106 GGGCAGGGGGCCATCTGCCGAGG No data
1057294655_1057294659 -8 Left 1057294655 9:93828069-93828091 CCAGGGCGGGCGGGCGGGCAGGG No data
Right 1057294659 9:93828084-93828106 GGGCAGGGGGCCATCTGCCGAGG No data
1057294653_1057294659 -7 Left 1057294653 9:93828068-93828090 CCCAGGGCGGGCGGGCGGGCAGG No data
Right 1057294659 9:93828084-93828106 GGGCAGGGGGCCATCTGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057294659 Original CRISPR GGGCAGGGGGCCATCTGCCG AGG Intergenic