ID: 1057294663 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:93828103-93828125 |
Sequence | GAGGCTGCCATCACATTCCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1057294653_1057294663 | 12 | Left | 1057294653 | 9:93828068-93828090 | CCCAGGGCGGGCGGGCGGGCAGG | No data | ||
Right | 1057294663 | 9:93828103-93828125 | GAGGCTGCCATCACATTCCTGGG | No data | ||||
1057294655_1057294663 | 11 | Left | 1057294655 | 9:93828069-93828091 | CCAGGGCGGGCGGGCGGGCAGGG | No data | ||
Right | 1057294663 | 9:93828103-93828125 | GAGGCTGCCATCACATTCCTGGG | No data | ||||
1057294648_1057294663 | 22 | Left | 1057294648 | 9:93828058-93828080 | CCGCTGGCGGCCCAGGGCGGGCG | No data | ||
Right | 1057294663 | 9:93828103-93828125 | GAGGCTGCCATCACATTCCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1057294663 | Original CRISPR | GAGGCTGCCATCACATTCCT GGG | Intergenic | ||