ID: 1057294663

View in Genome Browser
Species Human (GRCh38)
Location 9:93828103-93828125
Sequence GAGGCTGCCATCACATTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057294653_1057294663 12 Left 1057294653 9:93828068-93828090 CCCAGGGCGGGCGGGCGGGCAGG No data
Right 1057294663 9:93828103-93828125 GAGGCTGCCATCACATTCCTGGG No data
1057294655_1057294663 11 Left 1057294655 9:93828069-93828091 CCAGGGCGGGCGGGCGGGCAGGG No data
Right 1057294663 9:93828103-93828125 GAGGCTGCCATCACATTCCTGGG No data
1057294648_1057294663 22 Left 1057294648 9:93828058-93828080 CCGCTGGCGGCCCAGGGCGGGCG No data
Right 1057294663 9:93828103-93828125 GAGGCTGCCATCACATTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057294663 Original CRISPR GAGGCTGCCATCACATTCCT GGG Intergenic