ID: 1057297370

View in Genome Browser
Species Human (GRCh38)
Location 9:93857094-93857116
Sequence GGATTGTCCAGACAGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057297363_1057297370 13 Left 1057297363 9:93857058-93857080 CCACTGGAATTCCCATCTTGGAA No data
Right 1057297370 9:93857094-93857116 GGATTGTCCAGACAGCCAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 140
1057297360_1057297370 21 Left 1057297360 9:93857050-93857072 CCTTTTGCCCACTGGAATTCCCA No data
Right 1057297370 9:93857094-93857116 GGATTGTCCAGACAGCCAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 140
1057297365_1057297370 1 Left 1057297365 9:93857070-93857092 CCATCTTGGAAGAGTAAGCGCAG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1057297370 9:93857094-93857116 GGATTGTCCAGACAGCCAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 140
1057297362_1057297370 14 Left 1057297362 9:93857057-93857079 CCCACTGGAATTCCCATCTTGGA No data
Right 1057297370 9:93857094-93857116 GGATTGTCCAGACAGCCAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 140
1057297364_1057297370 2 Left 1057297364 9:93857069-93857091 CCCATCTTGGAAGAGTAAGCGCA 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1057297370 9:93857094-93857116 GGATTGTCCAGACAGCCAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057297370 Original CRISPR GGATTGTCCAGACAGCCAGG AGG Intergenic
901648577 1:10729457-10729479 GGACAGTCCAGGGAGCCAGGAGG + Intronic
909765030 1:79345007-79345029 TGATTCTCCAGAGAGACAGGAGG - Intergenic
910199288 1:84681959-84681981 GGATTGTTCATTAAGCCAGGGGG - Intronic
910238746 1:85063353-85063375 GGATTCTCCAGAGAGGGAGGTGG + Intronic
912516833 1:110221662-110221684 TGCCTGTCCACACAGCCAGGTGG + Intronic
914917065 1:151825363-151825385 GGATTGGGCAGAAAGCCTGGTGG + Intronic
915947798 1:160166797-160166819 GGTGAGTCCAGACAGACAGGAGG + Intronic
917704341 1:177616430-177616452 GGATTGCCCAGAAAGCCCTGAGG + Intergenic
918148782 1:181780763-181780785 GTCTTGTCCACAGAGCCAGGTGG + Intronic
920188784 1:204179244-204179266 GGTGTGTCCTGACTGCCAGGTGG + Intergenic
920198145 1:204243117-204243139 GCAGTGGCGAGACAGCCAGGGGG - Intronic
1071358120 10:84818495-84818517 GGAGTTCCCTGACAGCCAGGTGG + Intergenic
1073755900 10:106580232-106580254 AGATTGTGGAGACAGCCAGGTGG - Intronic
1075038009 10:119085462-119085484 AGCTTTTCCTGACAGCCAGGGGG + Intergenic
1075559264 10:123456660-123456682 AGAATGTCCAGCCAGCCACGTGG + Intergenic
1077286454 11:1768089-1768111 TGACTCTCCACACAGCCAGGAGG - Intergenic
1078000378 11:7490093-7490115 GGATTGTCAACACAGGCAGAGGG + Intronic
1078481176 11:11677040-11677062 AGATGCTGCAGACAGCCAGGTGG - Intergenic
1080050378 11:27852793-27852815 GGATGGTCAAGAAAGACAGGAGG - Intergenic
1082726475 11:56743082-56743104 GGATTCTCAGGATAGCCAGGAGG + Exonic
1086953594 11:92914557-92914579 TGCTGGTCAAGACAGCCAGGTGG - Intergenic
1090273479 11:125403990-125404012 GGATTTTCCAGATTGGCAGGGGG + Intronic
1090931283 11:131300125-131300147 AGAAGGACCAGACAGCCAGGAGG + Intergenic
1091667323 12:2428699-2428721 GAAATGTCCAGCCAACCAGGAGG - Intronic
1093825581 12:23683267-23683289 TGATTGTCCACACTGCCAGTGGG + Intronic
1097229174 12:57498706-57498728 GGAGTGCCCAGACAGCCACCCGG - Intronic
1098238342 12:68440537-68440559 GGATTATTCAGACAGCCAGCAGG + Intergenic
1102457551 12:113080106-113080128 GGAATGACCAGGCAGGCAGGTGG - Intronic
1102722137 12:115026185-115026207 GGATTCTTCATTCAGCCAGGAGG - Intergenic
1104602748 12:130164004-130164026 GGATGGCCCAGGCTGCCAGGTGG - Exonic
1104933891 12:132354450-132354472 GGAATGGCCAGGCAGCCGGGAGG + Intergenic
1106305403 13:28504781-28504803 GGCTTGCCCAGCCAGGCAGGGGG - Intergenic
1108044569 13:46371583-46371605 GGTGTTTCCAGACAGCCACGGGG - Intronic
1111396017 13:87671573-87671595 GGCTTGTCCTGGCAGCCCGGTGG - Intergenic
1119441520 14:74631649-74631671 GGACTGTCCTGAGACCCAGGAGG + Intergenic
1119667982 14:76498596-76498618 GGAGTCTGCACACAGCCAGGAGG - Intronic
1121615536 14:95311331-95311353 GGGTTCTCCATGCAGCCAGGAGG - Intronic
1127875641 15:63109113-63109135 GGATTGTATAGGCAGGCAGGGGG - Intergenic
1128090783 15:64917326-64917348 AGGTGGTCCAGGCAGCCAGGTGG + Intronic
1128890060 15:71323448-71323470 GGATTGTTCAGAGAGCCAGTGGG + Intronic
1132714589 16:1284414-1284436 GGGGTGTCCAGAAAGGCAGGCGG - Intergenic
1132980862 16:2738106-2738128 GGCTTGTCCTGCCAGCCTGGGGG - Intergenic
1134642059 16:15837216-15837238 GGTTTGTCTTGGCAGCCAGGTGG - Intronic
1134680205 16:16119819-16119841 GGATTGTTCAGAAAGCAAGCTGG + Intronic
1135095801 16:19563821-19563843 GGGCTATCAAGACAGCCAGGAGG - Intronic
1137360917 16:47814324-47814346 GGATAGTCCTGAAAGCCAGATGG - Intergenic
1139208826 16:65056226-65056248 GAAAGCTCCAGACAGCCAGGAGG + Intronic
1139329170 16:66174324-66174346 GGAGTGTCCAAAGAGCCAGAAGG + Intergenic
1141000221 16:80300791-80300813 GGTTTGTCCAGACAGCCACATGG - Intergenic
1147846768 17:43409940-43409962 GGATTATCCAGACCCCCAGCTGG - Intergenic
1148000098 17:44382830-44382852 GGAGTGTCCAGAGAGGGAGGAGG - Intronic
1148727968 17:49809669-49809691 GGAATGTTCAGAGAGGCAGGAGG - Intronic
1152811039 17:82382969-82382991 GGGCTGTCCACACAGCCTGGTGG - Intergenic
1153621372 18:6981370-6981392 GGATTGGCCAGAGATGCAGGTGG - Intronic
1153666250 18:7369824-7369846 GGATTGTGCAGACAGTGGGGGGG + Intergenic
1155757765 18:29523030-29523052 GGATTTACCAGAGAGCAAGGAGG - Intergenic
1156464272 18:37338904-37338926 GCATTGTCCAGAGAGAAAGGTGG - Intronic
1157449195 18:47772751-47772773 GGCTTGTCCAGACAGGAAGTCGG + Intergenic
1157520554 18:48342398-48342420 GGATTTTCAAGGCTGCCAGGAGG + Intronic
1158230279 18:55247202-55247224 GGATTGACCAGAAGGCCATGAGG - Intronic
1158575994 18:58638365-58638387 GGACTGCCCAGACAGCCAACGGG + Intergenic
1160921573 19:1523376-1523398 GGTTTGCACGGACAGCCAGGTGG - Intergenic
1166215259 19:41330802-41330824 GAATAGTGCAGACAGGCAGGAGG + Exonic
925386000 2:3461953-3461975 GGACCGCCCAGACCGCCAGGTGG - Intronic
931856583 2:66308197-66308219 GCATTATCCAGACAGCAATGAGG + Intergenic
932000124 2:67877452-67877474 TGATTCTCCAGACAGGCAGAGGG - Intergenic
934575096 2:95395183-95395205 GCACTGTCCTGAGAGCCAGGAGG + Intergenic
934662624 2:96151254-96151276 GGATTCTGGAGACAGTCAGGAGG - Intergenic
937788333 2:125928754-125928776 GGATATTCCAGACACCCAGAGGG + Intergenic
943528900 2:189053896-189053918 GGATTGCCCCGGGAGCCAGGAGG + Exonic
946413490 2:219527288-219527310 GGACTGGCCAGACTGGCAGGAGG - Intronic
1169134836 20:3190923-3190945 GGAAAGTCCAGGCAGGCAGGAGG - Intronic
1169190330 20:3654898-3654920 GGAATTTCCAGAGGGCCAGGAGG - Intergenic
1170138990 20:13106492-13106514 GCATTCTCCAGACAGACAAGAGG + Intronic
1171207777 20:23294555-23294577 GGATGGTCCAGACGGCTGGGAGG - Intergenic
1173035231 20:39402568-39402590 GGATTGTACAAAAAGCCATGTGG + Intergenic
1173393851 20:42659863-42659885 GGATTAACCAGACAGCATGGGGG - Intronic
1175714285 20:61245387-61245409 GGAGTCTCAGGACAGCCAGGAGG - Intergenic
1175912728 20:62412524-62412546 CCATTCTCCAGGCAGCCAGGAGG + Intronic
1176375364 21:6084460-6084482 GGCTTCTCCAGCCAGCCAGGGGG - Intergenic
1178989248 21:37338708-37338730 CCATGGTCCAGACAGCCACGTGG + Intergenic
1179748110 21:43453784-43453806 GGCTTCTCCAGCCAGCCAGGGGG + Intergenic
1181107872 22:20585383-20585405 GGATAGAGCAGACAGCCTGGCGG - Intronic
1182009221 22:26986346-26986368 AGATTGCTCAGACAGCAAGGCGG + Intergenic
1183825420 22:40382880-40382902 GAATTGGCCACACAGCCAAGTGG + Intronic
1183866506 22:40708471-40708493 GGATCATCCAGAGAGGCAGGAGG + Intergenic
949480548 3:4490732-4490754 GGATTATCCATACATACAGGCGG + Intergenic
953511742 3:43548136-43548158 GGATTGACCAGAAAGCCAGGTGG - Intronic
954663418 3:52237919-52237941 TGTTTGCCCAGACAGCCTGGCGG - Intronic
957608852 3:82441142-82441164 GGGTTGACCAGACACCCATGAGG + Intergenic
959541842 3:107549047-107549069 GGATGGTCCTGTCACCCAGGTGG - Intronic
959620441 3:108393911-108393933 TGATTTCCCATACAGCCAGGGGG - Intronic
961835128 3:129651645-129651667 GGACTGCCATGACAGCCAGGAGG + Exonic
969511994 4:7623433-7623455 GGAGTGGCCAGAGAGGCAGGGGG - Intronic
971156937 4:24093260-24093282 TGATTGTCAAAACAGCCAGTGGG - Intergenic
973545672 4:51979162-51979184 GGATGCTCCAGACAGGCAGCTGG - Intergenic
976289829 4:83406028-83406050 GGCTGGTCCAAACAGCCAGCAGG + Intergenic
977296526 4:95215821-95215843 AGATTGTCCAGAGAGACAAGTGG - Intronic
984600263 4:181718748-181718770 GGAATGTCCAGAGGGCCAGCTGG - Intergenic
986962551 5:13232839-13232861 CTATTGTCCAGCCAGCCAGTTGG - Intergenic
988502927 5:31798707-31798729 GGAGTGTCCATACAGCATGGAGG + Intronic
991086646 5:62653759-62653781 TGATTGACCTGACAGCCAGGAGG - Intergenic
997811228 5:136972666-136972688 GGAATGTCCAGAGAGGCAGGAGG + Intergenic
999378012 5:151100474-151100496 GAAATGTCCAGACAGCGAGAGGG + Intergenic
1001196647 5:169679041-169679063 GATTTGTCCAGACAGCAATGGGG + Intronic
1001809424 5:174616192-174616214 GGAGGGTCCAGAGAGCAAGGGGG + Intergenic
1001975320 5:175994019-175994041 GGAGTGTCCAGGCAGCAGGGTGG - Intronic
1002242113 5:177849751-177849773 GGAGTGTCCAGGCAGCAGGGTGG + Intergenic
1003946408 6:11080097-11080119 TGATTGTTCAGACATACAGGAGG - Intergenic
1004960121 6:20778759-20778781 GGCTCGTACAGACAGTCAGGAGG + Intronic
1013551236 6:111209691-111209713 GGAGTGGCCAGATAGGCAGGGGG + Intronic
1014546845 6:122745169-122745191 GGATGGATCAGACTGCCAGGTGG - Intergenic
1015833912 6:137398855-137398877 GGAATTTACAGACAGCCAAGGGG - Intergenic
1016899755 6:149089704-149089726 GGAATGTACAGTCAGCAAGGGGG + Intergenic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1019105525 6:169664162-169664184 GGGCTGTGCAGCCAGCCAGGTGG - Exonic
1019284910 7:218604-218626 GTCATGTCCAGAGAGCCAGGAGG - Intronic
1022137893 7:27466475-27466497 AGATTGTCCAGGTGGCCAGGGGG + Intergenic
1022363834 7:29689363-29689385 GGAGTGACCAGAGAGGCAGGGGG + Intergenic
1022697532 7:32724376-32724398 GGAGTGACCAGAGAGGCAGGGGG - Intergenic
1026290261 7:68999822-68999844 GGTCTGTTCAGTCAGCCAGGGGG - Intergenic
1029046942 7:97639823-97639845 TTATTGTCGAGACAGCTAGGTGG - Intergenic
1029402801 7:100356213-100356235 GCCTTGCCCAAACAGCCAGGGGG + Intronic
1029405446 7:100372074-100372096 GCCCTGCCCAGACAGCCAGGGGG + Intronic
1029481987 7:100818998-100819020 GAATTCTCGAAACAGCCAGGGGG - Intronic
1031268557 7:119614361-119614383 TGATTATTCAGTCAGCCAGGTGG - Intergenic
1032325338 7:130922958-130922980 GGGTTGTCAGGACAGCCTGGAGG - Intergenic
1033613350 7:142987058-142987080 GGCTTCTCCTGACAGCCTGGAGG - Intergenic
1036939930 8:13041552-13041574 GCATTTTCCAGGGAGCCAGGGGG - Intergenic
1038228314 8:25677044-25677066 GAATTGACCAGACAGGCAGCAGG - Intergenic
1039750454 8:40473705-40473727 GTACTGCCCAGCCAGCCAGGAGG - Intergenic
1039832098 8:41223608-41223630 GGATTCTCCAGAGAGCCAAGAGG + Intergenic
1040657091 8:49523275-49523297 GAATTGTCAAGAAAGGCAGGAGG - Intergenic
1040791959 8:51241291-51241313 GGTTTGTACAGAAAGCCAGGGGG + Intergenic
1041103288 8:54417938-54417960 GGATTTGCCAGGCAGCCAAGTGG - Intergenic
1045004505 8:97906290-97906312 GGCTTCTCCAGACTGCCATGGGG + Intronic
1046501668 8:115085723-115085745 GGATTGGAGAGACTGCCAGGGGG - Intergenic
1046581176 8:116094279-116094301 AGATTGTCCAGACAGGCATGTGG + Intergenic
1048849327 8:138629587-138629609 GGGTGGTCCAGGCAGCCAGACGG - Intronic
1049022098 8:139964313-139964335 GGATTCTCCAGACTGACAGATGG + Intronic
1049988696 9:973371-973393 GGAATGTCCAGCCAGGCAGTGGG - Intergenic
1052325206 9:27210347-27210369 GGTTTGTACAGAAAGTCAGGCGG - Intronic
1056356140 9:85803764-85803786 GGGTTGTCAAGACAGCCAGACGG - Intergenic
1056409838 9:86314114-86314136 GGATTGCACAGCCAGCAAGGGGG + Intronic
1056683390 9:88739629-88739651 GAAATGTCAAGATAGCCAGGAGG - Intergenic
1056684200 9:88746273-88746295 AGATTGAACAGACAGGCAGGTGG - Intergenic
1057297370 9:93857094-93857116 GGATTGTCCAGACAGCCAGGAGG + Intergenic
1061067143 9:128285631-128285653 GCATGATCCAAACAGCCAGGTGG - Intronic
1062366403 9:136211510-136211532 CGCTTGTCCAGAGAGCCTGGGGG + Intronic
1062406208 9:136397815-136397837 GGACTGTCCAGACTGCCATCTGG + Intronic
1189340276 X:40199858-40199880 GGATTGTCCACAAAGCGACGAGG + Intergenic
1191102405 X:56745938-56745960 GGATTTTACAGATAGCTAGGTGG + Intergenic
1193940815 X:87679253-87679275 GGATTTTGCAGATAGCCTGGGGG - Intergenic
1195110654 X:101645756-101645778 GGATAATACAGACAGGCAGGAGG + Intergenic
1196472475 X:116044116-116044138 GGCCTGTCCAGACAGTCAAGGGG - Intergenic