ID: 1057298187

View in Genome Browser
Species Human (GRCh38)
Location 9:93861331-93861353
Sequence CGCGGGACCACCCAGCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057298187_1057298195 1 Left 1057298187 9:93861331-93861353 CCTGAGTGCTGGGTGGTCCCGCG No data
Right 1057298195 9:93861355-93861377 AAAGTGCCTGGGGCTCTGCAGGG No data
1057298187_1057298191 -9 Left 1057298187 9:93861331-93861353 CCTGAGTGCTGGGTGGTCCCGCG No data
Right 1057298191 9:93861345-93861367 GGTCCCGCGGAAAGTGCCTGGGG No data
1057298187_1057298199 28 Left 1057298187 9:93861331-93861353 CCTGAGTGCTGGGTGGTCCCGCG No data
Right 1057298199 9:93861382-93861404 CAAGAGACCGCGTGCGGCCTGGG No data
1057298187_1057298200 29 Left 1057298187 9:93861331-93861353 CCTGAGTGCTGGGTGGTCCCGCG No data
Right 1057298200 9:93861383-93861405 AAGAGACCGCGTGCGGCCTGGGG No data
1057298187_1057298194 0 Left 1057298187 9:93861331-93861353 CCTGAGTGCTGGGTGGTCCCGCG No data
Right 1057298194 9:93861354-93861376 GAAAGTGCCTGGGGCTCTGCAGG No data
1057298187_1057298198 27 Left 1057298187 9:93861331-93861353 CCTGAGTGCTGGGTGGTCCCGCG No data
Right 1057298198 9:93861381-93861403 TCAAGAGACCGCGTGCGGCCTGG No data
1057298187_1057298197 22 Left 1057298187 9:93861331-93861353 CCTGAGTGCTGGGTGGTCCCGCG No data
Right 1057298197 9:93861376-93861398 GGCTCTCAAGAGACCGCGTGCGG No data
1057298187_1057298201 30 Left 1057298187 9:93861331-93861353 CCTGAGTGCTGGGTGGTCCCGCG No data
Right 1057298201 9:93861384-93861406 AGAGACCGCGTGCGGCCTGGGGG No data
1057298187_1057298190 -10 Left 1057298187 9:93861331-93861353 CCTGAGTGCTGGGTGGTCCCGCG No data
Right 1057298190 9:93861344-93861366 TGGTCCCGCGGAAAGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057298187 Original CRISPR CGCGGGACCACCCAGCACTC AGG (reversed) Intergenic
No off target data available for this crispr